onceforgivennowfree

[Gnug215]

Welcome aboard, Mugnuts!


I just wanted to make sure that your post wasn't buried, since I only just approved it.

I was wondering if it were in any way possible for the creation/ID camp to at least try something different. Instead of combating this process.
Why not attempt to adhere to the simplicity of the guidelines that have been attempted to be put in place? It is not hard in any way (really) to make an objection to a defined term and give a response pertaining to why, and coming to a common ground of what will and can be accepted. If you have evidence to counter a claim, then present it. It goes back and forth like that otherwise it goes how it has been going so far. NO WHERE.

Take a leap and go down the rabbit hole and see where it goes. If you want a posting of evidence , allow the process to commence politely and you will get a conversation instead of...well the last 15-20 pages of...not much.

What I get from AronRa regarding the defining terms phase is so both sides have a solid grounding. If there is a problem with a term, write it up in a sentence or two and give a source so he can read into it, and a compromise will be met. His words were quite clear on that. What you are not understanding is the other claims that follow after he has to repeat himself as most people will do, and start to advance a "Put up or Shut up" attitude. He has more than confidence that he has found the most recent, and relevant definition of these terms already and I would bet (heavily) that if you found concordant sources that disagreed with one or more of the terms, that a change would be made.

IF anyone makes a mistake, or error, on this site, I've seen them called on it, and when a correct point is made or knowledge is advanced, then credit and praise is also given.

Also it's the whole purpose of the discussion to read what has been presented. Read it all, read it again, and ask for help if something is not understood. Asking questions about uncertainty gains the most respect anywhere as it takes courage to admit you do not know or understand something.

 

[dandan]

Ok well I think I have all I need.....or all I'm going to get from AronRa. He clearly has no proof for Evolution. Rather, he has facts which he claims support and are concordant with Evolution, and which Creationists cannot account for. I keep waiting for the "magic bullet" proof from AronRa, but he's admitted he has none. He claims that his proof is the overwhelming preponderance of evidence. Ok, well he already gave a few of those, so I will simply address those in a video. I haven't addressed those point very much yet, because I was waiting for the real proof. Why should I spend all this time addressing circumstantial evidence if it's not actually AronRa's proof? I was waiting for his proof, but now it's become clear that it's not coming.

So since this is all that AronRa's got, I"ll create a video response where I can go in detail and show that AronRa is wrong about those (he is) and that Creationists CAN account for them. This will show that AronRa does not have good evidence for Evolution, and he most certainly does not have proof. He's also wrong when he says that Creationists cannot account for these facts he has presented. I'll start putting my thoughts together and provide a detailed response in the next week or so.

Thanks for your "proof" AronRa. That's all I wanted. If you have any BETTER evidence, let me know and perhaps I can address that in the future. For now, I will address the best that you have provided.

Regards,
OFNF

But we know that we are apes, in the same way we are mammals and vertebrates, and I the same way ducks are birds and dinosaurs are birds. This fact absolutely prove evolution, your challenge has been successfully answered.

 

[Dragan Glas]

Greetings,

What a surprise! OFNF refuses to meet the challenge he accepted, and after dozens of pages, he still will not answer any of the direct questions required before we can begin. So he is going to declare victory while simultaneously forfeiting by default for lack of participation. Who could have predicted that? Oh wait, I did -right at the start of this thread.

Considering this reply are you going to meet my challenge, or will our predictions also be vindicated

However Aron where were you in all this, I noticed that you were "mysteriously" absent whilst your fellows went to task with a 10 on one discussion... Do you really think, in all honesty, that that is fair? Considering that you claim to be a 'man of honour' one would think that your actions here contradict those remarks...

Given that OnceForgivenNowFree was equally - to use your phrase - "'mysteriously' absent" during most of the thread whilst the discussion continued between others, I hardly think you're making a telling point.

Aron responded to OnceForgivenNowFree when he posted.

He also responded to the other creationists - including Equestions (aka "creationist"), despite the latter bearing false witness to the contrary in the video OnceForgivenNowFree posted above.

OnceForgivenNowFree didn't respond much to anyone else - so I'm not sure to what this "10 on one" is referring.

And your continuing attempt to portray Aron as dishonourable as if he has orchestrated the rest of us into participating in this discussion whilst he's absent is actually dishonourable on your part.

You're also attempting to insinuate that he's duty-bound to debate you.

You already had that opportunity in two other threads, which you abandoned. You also were offered a opportunity for a one-on-one debate with Aron by Australopithecus - you didn't take up that offer either.

Kindly stop doing this - this is what's truly "insulting", to use your word.

Kindest regards,

James

 

[Dragan Glas]

Greetings,

Ok well I think I have all I need.....or all I'm going to get from AronRa. He clearly has no proof for Evolution. Rather, he has facts which he claims support and are concordant with Evolution, and which Creationists cannot account for. I keep waiting for the "magic bullet" proof from AronRa, but he's admitted he has none. He claims that his proof is the overwhelming preponderance of evidence. Ok, well he already gave a few of those, so I will simply address those in a video. I haven't addressed those point very much yet, because I was waiting for the real proof. Why should I spend all this time addressing circumstantial evidence if it's not actually AronRa's proof? I was waiting for his proof, but now it's become clear that it's not coming.

So since this is all that AronRa's got, I"ll create a video response where I can go in detail and show that AronRa is wrong about those (he is) and that Creationists CAN account for them. This will show that AronRa does not have good evidence for Evolution, and he most certainly does not have proof. He's also wrong when he says that Creationists cannot account for these facts he has presented. I'll start putting my thoughts together and provide a detailed response in the next week or so.

Thanks for your "proof" AronRa. That's all I wanted. If you have any BETTER evidence, let me know and perhaps I can address that in the future. For now, I will address the best that you have provided.

Regards,
OFNF

But we know that we are apes, in the same way we are mammals and vertebrates, and I the same way ducks are birds and dinosaurs are birds. This fact absolutely prove evolution, your challenge has been successfully answered.

And thank you, dandan, for making that point.

Now, if we could address the one remaining doubt you have by providing evidence that satisfies you...

Kindest regards,

James

 

[Gnug215]

What a surprise! OFNF refuses to meet the challenge he accepted, and after dozens of pages, he still will not answer any of the direct questions required before we can begin. So he is going to declare victory while simultaneously forfeiting by default for lack of participation. Who could have predicted that? Oh wait, I did -right at the start of this thread.

Considering this reply are you going to meet my challenge, or will our predictions also be vindicated

However Aron where were you in all this, I noticed that you were "mysteriously" absent whilst your fellows went to task with a 10 on one discussion... Do you really think, in all honesty, that that is fair? Considering that you claim to be a 'man of honour' one would think that your actions here contradict those remarks...

AronRa has not been absent. He has responded (in very reasonable time) to OFNF every time OFNF posted something.

And what "actions" do you mean? What is it that you think AronRa has actively done here?

I offered OFNF from the very start to set up a separate thread exclusively for him and AronRa, but he declined. I also told OFNF in that same post that he was free to ignore everyone else posting in the thread, because that was his prerogative - and he did so to a large extent, as far as I can tell. So this "10 on one" argument of yours doesn't really hold any water.
Your argument does, however, seems to be an attempt at character assasination of AronRa (and trying to make some kind of thinly veiled insult with regards to him being a "man of honor"), but you have no argument or evidence for what you suggest here. AronRa has not asked or otherwise egged or prodded any of us here to gang up on OFNF, or even post at all. And if you'll notice, throughout the thread, other creationists jumped on board on this thread, and most of the discussion was between them and the members here. AronRa and OFNF were both pretty good at responding mostly to each other, as was intended.

I repeated my offer to make a separate thread, but by then it was too late, for some reason. (Some reason that apparently seemed to have more to do with creationist being banned, rather than Aron's responses.)

 

[Visaki]

Greetings,

But we know that we are apes, in the same way we are mammals and vertebrates, and I the same way ducks are birds and dinosaurs are birds. This fact absolutely prove evolution, your challenge has been successfully answered.

And thank you, dandan, for making that point.

Now, if we could address the one remaining doubt you have by providing evidence that satisfies you...

Kindest regards,

James

Tough he's wrong on one point. Dinosaurs are not, in my admittingly limited understanding of taxonomy, birds but it is the other way around as birds are still dinosaurs. Other than that it's a rather poor attempt at sarcasm.

All in all this seems to have evolved into a typical creationism vs reality... I mean creationism vs evolution thread.

 

[Dragan Glas]

Greetings,

Tough he's wrong on one point. Dinosaurs are not, in my admittingly limited understanding of taxonomy, birds but it is the other way around as birds are still dinosaurs. Other than that it's a rather poor attempt at sarcasm.

All in all this seems to have evolved into a typical creationism vs reality... I mean creationism vs evolution thread.

Visaki, I think what he meant was - and I took him to mean - that birds are modern dinosaurs.

Also, I don't believe dandan is being sarcastic - he's disagreed similarly with creationist (Equestions) earlier in the thread.

It's one of the reasons why Aron pointed out that we don't know what creationists actually believe since they disagree on various aspects of evolution and the theory of evolution.

Kindest regards,

James

 

[he_who_is_nobody]

Ok well I think I have all I need.....or all I'm going to get from AronRa. He clearly has no proof for Evolution. Rather, he has facts which he claims support and are concordant with Evolution, and which Creationists cannot account for. I keep waiting for the "magic bullet" proof from AronRa, but he's admitted he has none. He claims that his proof is the overwhelming preponderance of evidence. Ok, well he already gave a few of those, so I will simply address those in a video. I haven't addressed those point very much yet, because I was waiting for the real proof. Why should I spend all this time addressing circumstantial evidence if it's not actually AronRa's proof? I was waiting for his proof, but now it's become clear that it's not coming.

So since this is all that AronRa's got, I"ll create a video response where I can go in detail and show that AronRa is wrong about those (he is) and that Creationists CAN account for them. This will show that AronRa does not have good evidence for Evolution, and he most certainly does not have proof. He's also wrong when he says that Creationists cannot account for these facts he has presented. I'll start putting my thoughts together and provide a detailed response in the next week or so.

Thanks for your "proof" AronRa. That's all I wanted. If you have any BETTER evidence, let me know and perhaps I can address that in the future. For now, I will address the best that you have provided.

Regards,
OFNF

But we know that we are apes, in the same way we are mammals and vertebrates, and I the same way ducks are birds and dinosaurs are birds. This fact absolutely prove evolution, your challenge has been successfully answered.

:!:

Yet again, another example that the creationists do not agree on what they deny. Several times dandan has spoken on behalf of all creationists, yet this is the second time I have seen him disagree and try to correct another creationist on this forum alone. Yet Oncefogivennowfree believes us silly evolutionists are just supposed to know what the creationists denies before engaging with them. How much more evidence does one need to see that AronRa strategy for dealing with creationists is the correct way to find out exactly what they deny?

 

[Inferno]

I'm slightly confused now. If dandan already agreed that evolution does happen, then why did we go through half of this thread?

 

[WarK]

I'm slightly confused now. If dandan already agreed that evolution does happen, then why did we go through half of this thread?

Maybe he's just trying to show us that he at least understands some things about evolution?

This would be something new from a creationist, to actually understand what science says. I'd say it was a step in good direction from "dogs give birth to cats" and other nonsense you usually get from creationists.

 

[Rumraket]

Greetings,

Thank you, dandan, for finally posting the paper.

The paper is from 2009 (published 2010), so it's slightly dated.

One thing I tend to do when faced with any paper is to check if it's been cited by anyone since publication and see what they say about the research - in this case, copy the title, right-click in Firefox, and "Search for ... in Google".

And sure enough a number of people (187) have cited it since - here's one (2012) as a example:

Rates and Fitness Consequences of New Mutations in Humans

Interestingly, he disagrees with Lynch.

So, where does that put the claim that deletions outnumber insertions?

Here's another (2012), which explores what the lower mutation rates mean for dating divergences between humans and other apes:

Revising the human mutation rate: implications for understanding human evolution

And here's another (2014) exploring the discrepancies between insertion-favouring versus deletion-favouring models, the need for caution and further research to identify mutation hotspots:

Strong Heterogeneity in Mutation Rate Causes Misleading Hallmarks of Natural Selection on Indel Mutations in the Human Genome

Kindest regards,

James

Does any of your papers refutes my premise? Does any of them states that mutations that destroy information are less frequent than does who increase it?

Please provide a method of quantifying information. How do you determine how much information there is in some given stretch of DNA?

If I give you the following string of DNA:

AUGGGUGGCGGAGGGCUUCUCUGA

Can you then tell me, by way of example, how you calculate the information quantity in it? Give me a formula, then use that formulate on my above string in an example calculation.

 

[MarsCydonia]

Well one good thing from Creationist revealing himself to be Equestions is that I have finally a small idea of what constitutes "evidence" for creationists as he has a number of videos called "Creation Evidence".

Of course, watching the videos makes it very clear how Equestions has a very different standard of evidence for creationism than for evolution, a particularly dishonest difference. Not that I am surprised.

 

[he_who_is_nobody]

Well one good thing from Creationist revealing himself to be Equestions is that I have finally a small idea of what constitutes "evidence" for creationists as he has a number of videos called "Creation Evidence".

Of course, watching the videos makes it very clear how Equestions has a very different standard of evidence for creationism than for evolution, a particularly dishonest difference. Not that I am surprised.

Would you say Equestions has double standards?

Oh, and I knew creationist was Equestions since he first started posting on this forum.

 

[MarsCydonia]

Would you say Equestions has double standards?

Oh, and I knew creationist was Equestions since he first started posting on this forum.

Actually no I would not say that since what I have learned from creationists such as Equestions is that although they have an impossibly high standard for evolution, we cannot say they have a double standard because a standard for creationism would also be required and they have absolutely none when it comes to creationism.

Anything and everything is often accepted without critical consideration if it is "evidence" for creationism.

Its quite obvious when seeing the videos from Equestions as he sees anything he does not understand or accept about evolution as "evidence" for creationism. Disproving evolution (which he certainly has not done so) would not make creationism true by default, it would still require evidence. And this is why I always ask creationists "why have you not rejected creationism?"

 

[Rando]

Would you say Equestions has double standards?

Oh, and I knew creationist was Equestions since he first started posting on this forum.

Actually no I would not say that since what I have learned from creationists such as Equestions is that although they have an impossibly high standard for evolution, we cannot say they have a double standard because a standard for creationism would also be required and they have absolutely none when it comes to creationism.

Anything and everything is often accepted without critical consideration if it is "evidence" for creationism.

Its quite obvious when seeing the videos from Equestions as he sees anything he does not understand or accept about evolution as "evidence" for creationism. Disproving evolution (which he certainly has not done so) would not make creationism true by default, it would still require evidence. And this is why I always ask creationists "why have you not rejected creationism?"

Of course it's a double standard. The reason for this is we're not just dealing with a scientific claim. If it was just science then there would be no problem with the evidence, we could present some scientific evidence and we would either be vindicated or prove wrong, but we would be willing to change our minds, if the evidence was sufficient. This is not the same when dealing with creationism, with creationism it's a part of their personality, a part of their lives, a part of their souls, to abandon it would be tantamount to cutting off their arm. That's the reason for the double standard.
You can see it happening on the "Does god exist" post, when challenged to produce evidence of hie god, Gilbo doesn't offer scientific experiments, verifiable evidence, or even peer-reviewed data, all he gave was apologetic arguments and "well WLC was never defeated." For all his talk about standards of evidence and calls for experiments, when it comes to his god, Philosophical Arguments are good enough. Go ahead challenge any creationist to produce a scientific experiment that proves the existence of god, and you'll get nothing. They will swear up and down that creationism is science, it belongs in class, that there is data supporting it, but at the end of the day, they will produce nothing.

But I'm more than willing to be proven wrong, Gilbo, Dandan, creationist, even OFNF produce one, just ONE scientific experiment, that shows the existence of god.

 

[AronRa]

The summary as I see it:

Apr 26 = I put up the first post and notified OFNF by commenting on his video. In that first post, I explain that I will not submit any work for him to simply ignore and dismiss misunderstood and unconsidered; that will only explain this in a two-way conversation, right here in this thread, because I want to make sure he understands what I'm saying, and that he must acknowledge each point as we progress.

Two weeks later, OFNF responds, and criticizes me for not notifying him.

I correct him, and ask whether he accepts the definitions.

He's confused by the post moderation

The next day, I clarify the terms of the discussion and repeat my unanswered question about whether he accepts the definitions. Because I already have to repeat myself, I warn him that he will forfeit this discussion if he repeatedly ignores direct questions.

OFNF accepts my definitions, amid some excuses and posturing -yet still trying to argue for an ambiguous misdefinition. But he sets a criteria that I must meet.

Again I explain the requirements, present a series of facts to see how many he accepts, and ask about specific data he might accept to meet his criteria.

Three days later, OFNF ignores all my questions, still trying to refuse the required education amid a lot more pointless posturing.

Two days later, I call his bluff, correct his misdefinition AGAIN, and repeat the necessary prerequisite questions for the second time.

OFNF says he'll post later. After a couple days, he does, still trying to evade any prerequisite understanding of the topic being discussed. This was when he changed his original answer to say that he no longer accepts even mIcroevolution.

Two days later, I showed that met his criteria. I corrected a couple of his errors, and asked the crucial question of what issue he had with each of the 3 most basic evolutionary facts in my list. This is a question he cannot answer because the only thing he could say is that it's against the Bible. Then I asked him what evidence he would need to change his mind in each case. He can't answer that question either, again because he is forbidden to accept any evidence against his interpretation of the Bible. But he can't admit that, because he knows what a dishonest position that is.

I suspect that he rejected all my facts without even reading them, and when I called him on that, he couldn't go back and correct himself. Neither could he ever present any evidence he would accept, because he knows I would present it. He knows that I already met his first two supposedly impossible challenges, so this would be no problem for me. So knowing that has no way to honestly respond, he disappeared for 12 days and came back with more pointless bluffing, trying to project his own faults onto me, and saying he didn't have to answer my questions.

This is an important point: If he really believed in his position the same way I believe in mine, then he would not act like this. He would not hesitate to answer anything I ask, and he wouldn't show all the back-arching trepidation that he did all the way through this thread.

That same day, I reminded him that, yes he does have to answer my questions; that we can't begin this discussion until he does. I also pointed out that he has to acknowledge that I had in fact already met his other criteria. Then I warned him that if he ignored those questions again, he would forfeit this conversation by default.

The next day, he tried to grab some excuse, an allegation of unfair treatment at the hands of the mods, in order to duck out of the conversation without having to secure his goalposts or acknowledge my already having met his criteria. When that didn't work, and there is no way he could bow out honorably, he declared victory, ...before we could begin, and after he had was already in default for non-participation.

 

[Mugnuts]

It's confuses me as to why they kept complaining about the coloured brain picture. I guess it means that just because you colour it, it ain't true...

...thus refuting bible colouring books all together.

 

[Onceforgivennowfree]

Thanks for your version of the events AronRa! Want to hear mine?

You accepted my challenge to prove evolution.

You didn't.

You claimed that I declared victory.

I didn't.

I said I would make a video in order to go over the evidence (or proof) you cited in detail.

So what's the problem? I will directly address your "evidence" and take the time to put some thought into it. You couldn't ask for more. Instead, you're panicking after having banned Creationist (just like Thunderf00t was banned from free-thought blogs) and you're creating straw men about me saying that I am declaring victory. I'm not.

 

[he_who_is_nobody]

Thanks for your version of the events AronRa! Want to hear mine?

You accepted my challenge to prove evolution.

You didn't.

You claimed that I declared victory.

I didn't.

I said I would make a video in order to go over the evidence (or proof) you cited in detail.

So what's the problem? I will directly address your "evidence" and take the time to put some thought into it. You couldn't ask for more. Instead, you're panicking after having banned Creationist (just like Thunderf00t was banned from free-thought blogs) and you're creating straw men about me saying that I am declaring victory. I'm not.

:facepalm:

AronRa[/url]"]I will accept both of your distinctly different challenges which you have posed as if they were one and the same. I will prove to your satisfaction that evolution is actually factual and have you concede that I have. In so doing, I will also allow you to demonstrate the failure of the 2nd part of your challenge, your imagined mystic magically manipulating reality behind the scenes. But I will not submit any work for you to simply ignore and dismiss misunderstood and unconsidered. I will only explain this in a two-way conversation, right here in this thread, because I want to make sure you understand what I'm saying, and that you acknowledge each point as we progress. Ultimately I want to end your career as a YouTube creationist and collect your admission in writing as a matter of public record. Are you up to it?

(Emphasis added.)

Did you miss that?

Onceforgivennowfree, since you have refused to answer direct questions, you have held up this discussion from the beginning. If you did not like that rule, you could have stated you were not up for a two-way conversation, instead of accepting it to begin with and backing out now. Either that or you could admit that you did not fully read/understand what AronRa was asking of you to begin with.

Furthermore, creationist was on a one-week ban for insults, which was over before he even posted his video, but creationists are not known for their honesty after all. He is free to post here whenever he likes.

 

[AronRa]

So what's the problem? I will directly address your "evidence" and take the time to put some thought into it. You couldn't ask for more. Instead, you're panicking after having banned Creationist (just like Thunderf00t was banned from free-thought blogs) and you're creating straw men about me saying that I am declaring victory. I'm not.

It will be of no value for you to 'go over' what you don't understand. So there is no point in your exposing your ignorance of what little evidence I showed to dandan when you stopped responding. The only way to meet your challenge was for you to participate by at least answering those prerequisite questions -which you refused to do.

It is very obvious to most people here that you're afraid to understand what you're forbidden to believe, and that's why you can't have this conversation the way a rational person would. You are in retreat. We all see that, and I think we all see the reason why too. Just remember, if you have to lie to defend your 'truth' then it was never really truth to begin with.