Educating a creationist about what evolution actually is.

[leroy]

Re: Educating a creationist about what evolution actually is

The only controversial point is weather if this discordance is statistically significant or not, but don´t worry Rumraket would provide us with a statistical equation and we would test if this discordance is significant or not.

Then do it. I dare you to do it. Power up your linux box, do a standard maximum likelihood phylogeny in PAML using 10 species, include bats and dolphins and use their cytochrome-c sequences. Then do the same using any one of those bat and dolphin proteins and then calculate the statistical significance of the incongruence.

The problem is that you don´t even understand the issue, I don’t ‘have to do any of that stuff, all I have to do is prove that it is impossible (or extremely unlikely) for 2 independent clades to have suffered from the same mutations 200 times in 30,000,000 years.

But before proving it, I would like to give you the opportunity to prove your statements mathematically, after all you are the one who is making the positive claim, you are the one who is saying that it is possible for 2 independent clades to suffer from the same mutations 200 times.

After you admit that You can´t prove your own assertions, I will prove to you that it is impossible (or very unlikely) 2 such an event to take place.

 

[Dragan Glas]

Re: Educating a creationist about what evolution actually is

Greetings,

There are a number of problems with your responses tp Nesslig20, leroy, but I'll just deal with #4 above.

4. Statement: "Paternity test are based on the assumption that our genes are a combination of mom and dad"
Correction: The fact that we inherit DNA from our parents is NOT an assumption you idiot!

Yes it is both a fact and an assumption, since you are clearly a disciple of Aronra, you think that “assumtions” and “facts” are mutually exclusive, but the truth is that an assumption can be an undisputed fact and still be an assumption.

An assumption is made without proof.

However, paternity tests are based on the observation that evolution results in descendants inheriting genes from ancestors - this was already known, and shown to be true before DNA testing was used to decide paternity of children.

In other words, it's not an assumption - it's already been proven to be the case. It was an application of pre-existing knowledge.

This is the point that you're missing.

And it's symptomatic of your lack of understanding as shown in your other answers above, and throughout this thread.

Kindest regards,

James

 

[Nesslig20]

Re: Educating a creationist about what evolution actually is

Nesling is correct in pointing this:

But the genes as a whole are not identical. Let me demonstrate.
I took the nucleotide sequences of the prestin genes of both echolocating bats and echolocating dolphins and compare it with the sequences of their relatives that don't echolocate. You can do this too using NCBI blast.

Sure the genes as a whole, are probably consistent with the nested hierarchy pattern

Then do you admit these errors you made about echolocation of bats and dolphins being almost identical even at the molecular level and do you accept the corrections, yes or no?

6. Statement: "Ecolocation in bats and dolphins is almost identical"
Correction: Echolocation involves generating and emitting sound waves and receiving the echo. Bats generate sound with their larynx and emit sound via their open mouth or nostrils. Dolphins generate sound by passing air from the bony nares through the phonic lips and emit it by reflecting the sound waves by the thick concave bone of the cranium and the sound is modulated by the fatty organ called the 'melon'. Very different mechanisms of echo location. The only identical thing about their method of echolocation is they use hearing to receive the echo, and guess what, both bats and dolphins inherited hearing from their common ancestor.

7. Statement: "identical even at a molecular level"
Correction: One gene in particular, called prestin, that is involved in echolocation of certain bats and dolphins, which your own citation gave, are more similar in their close, non echo locating, relatives than between them. Not identical.

And while you are at it, what about these?

1. Statement: "The fact that we share some percentage of DNA with chimps doesn’t prove that we are related"
Correction: Genetic similarity does prove relatedness, we use it in paternity tests.

2. Statement: "First of all, paternity test can only tell you if someone is your father or mother, and with a low degree of certainty."
Correction: Paternity tests can be 99.99% reliable and if you have a son, father and grandfather. You can use two paternity tests (one on son and father and another one on father and grandfather) to demonstrate son and grandfather relationship with 99,98% reliability.

3. Statement: "no judge would ever accept a paternity test for a great grandfather."
Correction: Judges Do accept the validity of paternity tests.

4. Statement: "Paternity test are based on the assumption that our genes are a combination of mom and dad"
Correction: The fact that we inherit DNA from our parents is NOT an assumption you idiot!

5. Statement: "the science of paternity tests and the science that is supposed to prove universal common ancestry are not the same"
Correction: They are since both rely on Genetics and use DNA comparison of genetic homology. The only difference is scale, as in the difference between inches and miles.

however it is still a fact that there are discordances in portions of these genes, and the problem remains the same:

Yes a discordance of 200 places in 805,053 amino acids within 2,326 orthologous coding sequences.
200 / 805053 x 100 = 0,025% Not very significant.

And those small discordances are expected, and I can test that too. Let have four different lineages that inherited a gene of 21 nucleotides from a common ancestor and the common ancestor had these 21 nucleotide sequence:

ATGGACTGATCGATCGCTATT (ancestral state)

After that it split in two lineages and they begin to experience random mutations in independently, each get 5 mutations. (I used a random mutator program)

1.ggGGACTGATcGATCGgTtTT

2. AaGGACcGAcCGaTCGaTATT

And each of those 2 split again in 2 and each of those once again get 5 mutations.

1A. ggGGACTGATcgaaCGgTcTT
1B. ggaGACTGcacGATCGgtttT

2A. AagGACtGccCGcTCGaTATT
2B. AacGACcGtcCtaTCcaTgTT

Now 1A and 1B should be closer relatives and 2A and 2B also closer relatives then 2A/B and 1A/B are to each other.
And if align them and see where they match and don't match we get this.

As a whole:
1A - 1B are 16 out of 21 identical
2A - 2B are 14 out of 21 identical
1A - 2A are 13 out of 21 identical
1B - 2B are 11 out of 21 identical

So closer relatives are still more identical, but if you focus on certain position like at nucleotide 3
1A has G
1B has A
2A has G
2B has C

So at this singular position, 1A and 2B are more similar then to their close relatives, a discordant that was caused just by random chance alone and the discordance of 200 was caused by random mutation plus natural selection (not chance).
Thus discordances are always expected, and this is why the certainty of a paternity test increases the more data there is used.

You have to prove that it is statistically possible to get 200 identical mutation in the same proteins mutations in 2 independent clades. (well actually the article mentions 3 clades but let’s keep it in 2)

I just did a simulation that mutated sequences by random chance and of 21 nucleotides I already got 1 which I showed and there are also another one at position 9. That already shows that it is statistically possible.
And I can give a real world example with the Lenksi experiment.
12 separate populations of E.coli where grown and after 20.000 generations, the gene expressions of two populations where tested and compared to their ancestors. They found that 59 genes had changed in the same way independently in both populations. Thus it is quite possible, it happens all the time. Here is the [ur=http://www.pnas.org/content/100/3/1072.full.pdfl]article[/url] and here is a review of the experiment of it.

 

[Nesslig20]

Re: Educating a creationist about what evolution actually is

I've also noticed a theme here. These are some of your statements that I've corrected.

1. Statement: "The fact that we share some percentage of DNA with chimps doesn’t prove that we are related"
Correction: Genetic similarity does prove relatedness, we use it in paternity tests.

Grated, my only objection on this is that design hypothesis would also predict genetic and anatomical similarities.

Design would predict that similarities, possible and expected

Common ancestry would predict similarities and a nearly perfect nested hierachy

And we do see the nearly perfect nested hierarchy.

2. Statement: "First of all, paternity test can only tell you if someone is your father or mother, and with a low degree of certainty."
Correction: Paternity tests can be 99.99% reliable and if you have a son, father and grandfather. You can use two paternity tests (one on son and father and another one on father and grandfather) to demonstrate son and grandfather relationship with 99,98% reliability.

Ok wrong wording on my side, What I was trying to say is that paternity test can tell you if someone is your father and with a lower degree of certainty if someone is your grandfather.

My only point was that son-father test are more reliable than grandfather-grandson test, (but both tests are reliable)

Alright nothing to say here.

3. Statement: "no judge would ever accept a paternity test for a great grandfather."
Correction: Judges Do accept the validity of paternity tests.

You didn´t read my comment, I said that no judge will ever accept a “grate grand parent---grate grand son test” after 2 generations the test becomes unreliable.

You didn't understand me. Paternity test, by definition, only works in paternity relationship. If you have a son and a father and a grandfather you can use two paternity test to prove grandson and grandfather relationship with high accuracy.

You could argue that after 3 or 4 generations the result are still more less reliable, but not after millions of generations.

That's not the point of why I brought paternity test. A paternity test is a test that compares genetic homologs or in often cases STRs (short tandem repeats), and can only demonstrate relatedness at a small scale (paternity scale).
Of course you cannot use a paternity test to prove that humans and chimps are related, in that case you use many genetic orthologs.

4. Statement: "Paternity test are based on the assumption that our genes are a combination of mom and dad"
Correction: The fact that we inherit DNA from our parents is NOT an assumption you idiot!

Yes it is both a fact and an assumption, since you are clearly a disciple of Aronra, you think that “assumtions” and “facts” are mutually exclusive, but the truth is that an assumption can be an undisputed fact and still be an assumption.

Assumption
noun
- a thing that is accepted as true or as certain to happen, without proof.

Fact
noun
- a thing that is known or proved to be true.

And I'm not a disciple of Aron, though I do like his video's allot.

5. Statement: "the science of paternity tests and the science that is supposed to prove universal common ancestry are not the same"
Correction: They are since both rely on Genetics and use DNA comparison of genetic homology. The only difference is scale, as in the difference between inches and miles.

Ok, with paternity test I am assuming that you are talking about those tests that use restriction enzymes to cut DNA, if you are retiring to other type of paternity test please let us know exactly to what paternity test are you talking about.

http://sterichindrance.tumblr.com/post/68277805329/your-dna-vs-legal-practice-vs-privacy

With that said, please provide an article that proves that humans and chimps share a common ancestor, where the researches used restrictions enzymes to cut DNA to determine that chimps and humans are related.
The researches have to use the same method used in paternity tests.

Again misunderstanding why I brought up paternity test. Paternity test can only determine PATERNITY!

6. Statement: "Ecolocation in bats and dolphins is almost identical"
Correction: Echolocation involves generating and emitting sound waves and receiving the echo. Bats generate sound with their larynx and emit sound via their open mouth or nostrils. Dolphins generate sound by passing air from the bony nares through the phonic lips and emit it by reflecting the sound waves by the thick concave bone of the cranium and the sound is modulated by the fatty organ called the 'melon'. Very different mechanisms of echo location. The only identical thing about their method of echolocation is they use hearing to receive the echo, and guess what, both bats and dolphins inherited hearing from their common ancestor.

Ok, I apologize for that, I overestimated the implications of the article about echolocation, the article does not sat that echolocation in bats and dolphins is identical, (that statement has never been proven nor disproven)

Alright.

What the article says is that bats and dolphins are identical in 200 loci where closer relatives have differences.
But it is still a fact that if you what to argue convergent evolution, you have to prove that it is statistically possible to get 200 mutation in the exact same protein in the exact same loci in 2 independent clades.

Did in my last previous reply.

7. Statement: "identical even at a molecular level"
Correction: One gene in particular, called prestin, that is involved in echolocation of certain bats and dolphins, which your own citation gave, are more similar in their close, non echo locating, relatives than between them. Not identical.

Yes that is true, the gene perstin as a whole forms a consistent nested hierachy, but there are some portions of this protein where the nested hierchy pattern is broken.

Portions that are inconsistent is always expected under common ancestry. Also explained in my previous reply.

And it is still a fact that your model requires that 2 independent clades suffered from the same mutation independently, you have to prove that such an event is statistically possible.

Also done in the previous reply.

Do you honestly admit your errors and accept the correction?

Yes I made some minor mistakes, but you still have two challenges
1 prove that it is possible to get 200 mutations in 2 independent clades(obviously this mutations have to survive natural selection and genetic drift)

Done in my previous reply. And natural selection is what selected these 200 mutations as the article mentioned.
"Strong and significant support for convergence among bats and the bottlenose dolphin was seen in numerous genes linked to hearing or deafness, consistent with an involvement in echolocation. Unexpectedly, we also found convergence in many genes linked to vision: the convergent signal of many sensory genes was robustly correlated with the strength of natural selection."
Thus they have no problem surviving natural selection, because they persist because of it.

2 provide an article that proves the common ancestry model USING THE SAME METHOD, used in paternity tests.

Again, paternity only shows paternal relationship. But here is an report that cites several articles on genetics and more that demonstrates common ancestry.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2409108/

 

[leroy]

Re: Educating a creationist about what evolution actually is

Greetings,

There are a number of problems with your responses tp Nesslig20, leroy, but I'll just deal with #4 above.

4. Statement: "Paternity test are based on the assumption that our genes are a combination of mom and dad"
Correction: The fact that we inherit DNA from our parents is NOT an assumption you idiot!

Yes it is both a fact and an assumption, since you are clearly a disciple of Aronra, you think that “assumtions” and “facts” are mutually exclusive, but the truth is that an assumption can be an undisputed fact and still be an assumption.

An assumption is made without proof.

However, paternity tests are based on the observation that evolution results in descendants inheriting genes from ancestors - this was already known, and shown to be true before DNA testing was used to decide paternity of children.

In other words, it's not an assumption - it's already been proven to be the case. It was an application of pre-existing knowledge.

This is the point that you're missing.

And it's symptomatic of your lack of understanding as shown in your other answers above, and throughout this thread.

Kindest regards,

James[/quote]


It is funny that of all my statements, you decided to “refute” an irrelevant statement that only deals with semantics and the proper use of terms.

Something can undeniable true and an assumption at the same time, for example GPS technology assumes that the theory of relativity is correct. This doesn’t mean that the theory of relativity is controversial; it simply means that GPS engineers accept the theory of relativity.

There may or may not be good reasons to make an assumption, for example it is valid to assume the theory of relativity because this theory has already been proven

 

[leroy]

Re: Educating a creationist about what evolution actually is

[Yes a discordance of 200 places in 805,053 amino acids within 2,326 orthologous coding sequences.
200 / 805053 x 100 = 0,025% Not very significant]

How do you know that .025% is not significant? What metric are you using? What if we have a 0.030% or a 1% or a 2% ¿at what point would you call it significant?

So at this singular position, 1A and 2B are more similar then to their close relatives, a discordant that was caused just by random chance alone and the discordance of 200 was caused by random mutation plus natural selection (not chance).

Related to the 200 mutations…
Why not using the actual values instead of using a simulation?

A) How probable is it for 2 organisms to suffer from the same mutation in the same loci ?

B) How probable is it for a mutation to survive natural selection and genetic drift?

Then Multiply A and B and multiply the result times 200.

The result would tell you how improbable the event is.

Then you have to compare the result with your probabilistic resources.

If you need any help, I can do the math for you, and prove that it is impossible (or extremely unlikely) for 2 organisms to suffer from them same 200 mutations.

 

[leroy]

Re: Educating a creationist about what evolution actually is


Ok, so at the end of the day, you agree with my original point.

The science of paternity test and the science that is supposed to prove universal common ancestor are not the same. Proving one doesn´t necessary prove the other.

 

[SpecialFrog]

Re: Educating a creationist about what evolution actually is

No, I can also say that you are equivocating by trying to pretend that similarities in proteins means genetic similarities (which is what you claimed above). Moreover, you are trying to pretend that common ancestry inherently predicts a certain hierarchy of proteins<i></i> produced by organisms. .

No, obviously I am aware of the fact that the common ancestry model would predict some discordances (or mismatches) the common ancestry model doesn’t predict a perfect nested hierarchy.

You emphasized the wrong part of my point. I have fixed it.

It has been pointed out to you repeatedly that if you look at the genes that produce the proteins you are talking about you do not see the discordance above. The wording of your argument suggests you accept this (though you seem reluctant to admit it).

Yes in fact the article on echolocation is referring to genes that code for the proteins, so when I mentioned “proteins” I really meant the genes that code for those proteins.

analyses of convergent sequence evolution in 805,053 amino acids within 2,326 orthologous coding gene sequences compared across 22 mammals (including four newly sequenced bat genomes) revealed signatures consistent with convergence in nearly 200 loci. Strong and significant support for convergence among bats and the bottlenose dolphin was seen in numerous genes linked to hearing or deafness, consistent with an involvement in echolocation. Unexpectedlyhttp://www.nature.com/nature/journal/v502/n7470/abs/nature12511.html

First of all, this is a nice quote mine. "Unexpectedly" refers to the next sentence, not the previous one.

Unexpectedly, we also found convergence in many genes linked to vision: the convergent signal of many sensory genes was robustly correlated with the strength of natural selection.

Secondly, the articule is not saying what you are claiming it is saying. If you read his posts more carefully you would see that Nesslig20 showed the degree of relatedness for one of the specific genes being discussed in the paper<i></i>, not for the complete genome. Even then, the tree produced is consistent with the species tree. You only produce a discordant tree if you do it from the proteins produced and not the genes.

I think part of the issue is you are failing to understand the term "orthologous".

Particularly the article mentions 200 loci where this discordance takes place. Therefore if you “what to argue convergent evolution” you are arguing that 2 independent clades had the exact same mutations<i></i> in the exact same proteins 200 times

Except that the article doesn't say any such thing occurred. Setting aside your continued equivocation between "protein" and "gene", each of these loci is a functionally-equivalent mutation occurring at the equivalent point in the orthologous genes of each clade. Do you recognize the difference between this and "the exact same mutations"?

Nesling is correct in pointing this:

But the genes as a whole are not identical. Let me demonstrate.
I took the nucleotide sequences of the prestin genes<i></i> of both echolocating bats and echolocating dolphins and compare it with the sequences of their relatives that don't echolocate. You can do this too using NCBI blast.

Sure the genes as a whole, are probably consistent with the nested hierarchy pattern however it is still a fact that there are discordances in portions of these genes,

As pointed out above, you are not actualy reading what he is saying. These portions of the gene are still not discordant.

So lets combine three facts that we have established.

1) The exact same mutations have not occurred in each species. Only equivalent ones.
2) The same amino acid sequences can be produced by different gene sequences, meaning that there are potentially a number of possible equivalent mutations at a given locus.
3) Despite these convergences, the affected genes of bats and dolophins are still closer to their presumed relatives than they are to each other.

How precisely is this a problem for the common ancestry model?

 

[Rumraket]

Re: Educating a creationist about what evolution actually is

But you don´t have unlimited time, cetaceans that use sonar where suppose to diverge from those who doesn´t use sonar 30,000,000 years ago.
Is 30,000,000 years enough time?

But bats and dolphins aren't of course THAT distantly related, so in this case the question becomes if 200 mutations showing bats and dolphins as more closely related, than the rest of their genes, is enough to represent a statistically significant incongruence

Ok, but how do you know that 200 is not an issue? Show me your math.
What if instead of 200 there where 300 or 400 or 1,000 at what point would you say that the discordance is significant, please show me your statistical model.

You want a fucking lecture on consistency index? Then go here: http://taxonomy.zoology.gla.ac.uk/teaching/Cladistics.pdf

Download that, then go read how to do a Consistency Index. Have fun.

 

[Rumraket]

Re: Educating a creationist about what evolution actually is

The problem is that you don´t even understand the issue, I don’t ‘have to do any of that stuff, all I have to do is prove that it is impossible (or extremely unlikely) for 2 independent clades to have suffered from the same mutations 200 times in 30,000,000 years.

It is impossible to prove that it is impossible, since it is merely a matter of probability. Low odds aren't impossible, they're just low. This is so basic as to be unbelievable that a grown man doesn't know the difference between an unlikelihood and an impossibility.

When you talk about possibility, what kind do you even mean? Physically impossible? Logically impossible? Mathematically impossible?

But before proving it, I would like to give you the opportunity to prove your statements mathematically, after all you are the one who is making the positive claim, you are the one who is saying that it is possible for 2 independent clades to suffer from the same mutations 200 times.

Their genomes exist, all the nucleotides in their genomes can potentially mutate. The only way to prove it is impossible is to take issue with this basic inference and then doing some kind of demonstration that even subjected to direct physical manipulations, radiation, chemical pollutants or polymerase copying errors, mutations still do not happen in their genomes. But surely we agree they do, and surely we agree that it is at least possible for every nucleotides in their genomes to change due to some kind of physical disturbance, whether that is radiation, a chemical pollutant, the brownian motion of a copying polymerase or whatever?

Or are you going to turn this around and demand that we prove to you that every nucleotide is physically possible to mutate or can we just take it for granted that mutations can happen? Surely you can see the idiocy of demanding over the internet something like a demonstration that all the nucleotides in the genome of some particular organism are physically possible to mutate?

If we can get past absurdities like that, then I hope we can agree it is by definition a matter of probability. Not possibility. Right?

After you admit that You can´t prove your own assertions, I will prove to you that it is impossible (or very unlikely) 2 such an event to take place.

You don't have to bother proving it is unlikely, I already know that. But I'm curious how you would prove it to be impossible.

Whether 200 identical mutations spread throughout their genomes, out of the total number of mutations that separate them, represents a statistically significant incongruence I actually don't know. This is all assuming, of course, that there really are such 200 identical mutations having independently happened in both lineages. I think Mr. Nesslig has been giving us some pretty significant reasons to doubt it. Before getting your knickers in a twist about the statistics, perhaps you should first investigate what is actually the facts of the matter.

To what degree are their physiological echolocating apperatus, and the underlying genetics, actually convergent? We need specifics. And when we have those, it might be possible for us to try estimate the significance of the incongruence represented by that data, if any.

 

[Rumraket]

Re: Educating a creationist about what evolution actually is

Again, paternity only shows paternal relationship. But here is an report that cites several articles on genetics and more that demonstrates common ancestry.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2409108/ ]

Ok, so at the end of the day, you agree with my original point.

The science of paternity test and the science that is supposed to prove universal common ancestor are not the same.

False.

Proving one doesn´t necessary prove the other.

The underlying methodology is the same.

 

[Dragan Glas]

Re: Educating a creationist about what evolution actually is

Greetings,

Greetings,

There are a number of problems with your responses tp Nesslig20, leroy, but I'll just deal with #4 above.

An assumption is made without proof.

However, paternity tests are based on the observation that evolution results in descendants inheriting genes from ancestors - this was already known, and shown to be true before DNA testing was used to decide paternity of children.

In other words, it's not an assumption - it's already been proven to be the case. It was an application of pre-existing knowledge.

This is the point that you're missing.

And it's symptomatic of your lack of understanding as shown in your other answers above, and throughout this thread.

Kindest regards,

James

It is funny that of all my statements, you decided to “refute” an irrelevant statement that only deals with semantics and the proper use of terms.

The point being that if you can get something as simple as this wrong, it is no wonder you're getting the important things wrong.

Something can undeniable true and an assumption at the same time,...

... Yes ...

... for example GPS technology assumes that the theory of relativity is correct. This doesn’t mean that the theory of relativity is controversial; it simply means that GPS engineers accept the theory of relativity.

No, you're still not understanding the point.

There may or may not be good reasons to make an assumption, for example it is valid to assume the theory of relativity because this theory has already been proven

The point, which you state but don't seem to understand is that, you might assume something beforehand, where you don't have any evidence of its veracity but are - turn out to be - right.

You might believe that the price of cabbages will go up - you have no evidence for that but... - and, as a result, you buy lots of cabbages. Subsequently, the price goes up - thus you were right. After the fact.

This is the definition of an assumption.

However, if you have evidence that the price is already going up, and that all the evidence is it's likely to continue to rise, and only then start buying cabbages, this is not an assumption - because you're basing what you do on evidence, not on a lack of it.

Understand?

Your GPS example is not an assumption - because the theory of relativity has all the evidence needed to show that it's true. Engineers are basing their design of the GPS system on science, not faith.

DNA paternity tests are based on the overwhelming scientific evidence that (the theory of) evolution is true - it's based on science, not faith.

Assumptions are faith-based (without evidence) - not based on (pre-)existing evidence.

Kindest regards,

James

 

[he_who_is_nobody]

Re: Educating a creationist about what evolution actually is

Rumraket will soon provide this model; we simply have to be patient.

Rumraket has already provided it here, here, and here. Rumraket can only lead a horse to water so many times.

I've also noticed a theme here. These are some of your statements that I've corrected.

1. Statement: "The fact that we share some percentage of DNA with chimps doesn’t prove that we are related"
Correction: Genetic similarity does prove relatedness, we use it in paternity tests.

Grated, my only objection on this is that design hypothesis would also predict genetic and anatomical similarities.

Design would predict that similarities, possible and expected

Common ancestry would predict similarities and a nearly perfect nested hierachy

Design can only predict this ad hoc. Why do chimpanzees and horses have similar eyes? DesignerDIdIt. Why do squid have different eyes from horses and chimpanzees? DesignerDidIt. You see how that is not a real prediction, right?

Something can undeniable true and an assumption at the same time, for example GPS technology assumes that the theory of relativity is correct. This doesn’t mean that the theory of relativity is controversial; it simply means that GPS engineers accept the theory of relativity.

There may or may not be good reasons to make an assumption, for example it is valid to assume the theory of relativity because this theory has already been proven

:lol:

The gymnastics you are performing should win you a gold medal.

If you need any help, I can do the math for you, and prove that it is impossible (or extremely unlikely) for 2 organisms to suffer from them same 200 mutations.

:lol:

Seeing as Nesslig20 is the only one showing his math, why not stop pretending you have a trump card and display your superior math skills. We could all use a good laugh.

Ok, so at the end of the day, you agree with my original point.

The science of paternity test and the science that is supposed to prove universal common ancestor are not the same. Proving one doesn´t necessary prove the other.

:facepalm:

Nesslig20[/url]"]That's not the point of why I brought paternity test. A paternity test is a test that compares genetic homologs or in often cases STRs (short tandem repeats), and can only demonstrate relatedness at a small scale (paternity scale).
Of course you cannot use a paternity test to prove that humans and chimps are related, in that case you use many genetic orthologs.

[Emphasis added.]

You know, it would really help if you started reading what people are telling you. So much time would not have to be wasted repeating it later for you.

It is impossible to prove that it is impossible, since it is merely a matter of probability. Low odds aren't impossible, they're just low. This is so basic as to be unbelievable that a grown man doesn't know the difference between an unlikelihood and an impossibility.

When you talk about possibility, what kind do you even mean? Physically impossible? Logically impossible? Mathematically impossible?

Remember, this is coming from the same guy that thinks magick is real.

 

[Nesslig20]

Re: Educating a creationist about what evolution actually is

[Yes a discordance of 200 places in 805,053 amino acids within 2,326 orthologous coding sequences.
200 / 805053 x 100 = 0,025% Not very significant]

How do you know that .025% is not significant? What metric are you using? What if we have a 0.030% or a 1% or a 2% ¿at what point would you call it significant?

Well if you compare to something practical like for example what is considered pure silver should contain 99,9% silver with the remaining 0,01% trace amounts of impurities, which is considered not significant.
If we used such a metric in this case we have a "pure" consistency with 99,975% consistency, with the remaining 0,025% discordance considered not significant.

But we can also use the p-value. If you don't know, the p-value is the value which scientists consider statistical significance.
A low p-value means that the data is statistically significant, a high p-value is not statistically significant.
And p-value is given from 0,00 to 1,00 which corresponds to percentage 0% to 100%
If the p value is 0 or 0% then it is highly significant if it is 1,00 or 100% then it is absolutely not significant.
Scientist usually use the threshold of 0,05 or 5%. A p-value below this threshold it is significant, above it is not significant.
You can calculate it too, although first you need to calculate the chi square value (X^2), which is this equation.

X^2 = (O - E)^2 / E
O = observed value
E = expected value

Now if we give an example, like we expect of 100 to be 100 and we do see 100 to be 100 then
X^2 = ( 100 - 100 )^2 / 100 = 0
And a chi square value of 0 gives a p-value of 100%, thus our observation is 100% not significantly different from our expectation, which makes sense since we expected 100 of 100 and we got 100 of 100.
Now if we expect that out of all of the 805.053 amino acids between echolocating bats and dolphins not one should show discordance, which is unreasonable, I think we should always expect some discordances, but for the sake of argument, we say we expect NO discordance, thus:
E = 805.053
But our observation gives that 200 of those 805.053 do show a discordance, thus
O = 804.853
Now to calculate whether or not the discordance is significant or not.
X^2 = ( 804.853 - 805.053)^2 / 805.053 = 0,049686
Converting the chi square value to p-value can be done here
A chi square value of 0,049686 gives p-value = 0.823761 or 82% which is far above the 5% threshold thus the discordance is not significant.

So at this singular position, 1A and 2B are more similar then to their close relatives, a discordant that was caused just by random chance alone and the discordance of 200 was caused by random mutation plus natural selection (not chance).

Related to the 200 mutations…
Why not using the actual values instead of using a simulation?

The simulation was to demonstrate that small discordances are always expected with common ancestry and random mutations happening in separate lineages thus discordances in portions of genes isn't a problem for common ancestry and this demonstration was meant specifically to address this statement of yours:

however it is still a fact that there are discordances in portions of these genes, and the problem remains the same:

It was not meant to demonstrate that the 200 mutations where not significant.

A) How probable is it for 2 organisms to suffer from the same mutation in the same loci ?
B) How probable is it for a mutation to survive natural selection and genetic drift?
Then Multiply A and B and multiply the result times 200.
The result would tell you how improbable the event is.
Then you have to compare the result with your probabilistic resources.

I can't answer that question since I don't have the data to do that calculation. Although one error you made is considering natural selection as if it where to decrease the probability of the mutations persisting, in reality it is the opposite case, natural selection INCREASES the survivability of beneficial mutations as these 200.
But still I can't answer your question, because you would need:
1. The genome size of each lineage.
2. The population size of each lineage
3. The mutation rate per generation in each lineage.
4. The amount of generations after each lineage split.
5. The effect of natural selection on the survivability on the mutations.
6. The effect of genetic drift on the survivability on the mutations.

I don't have any of these data that I need.

If you need any help, I can do the math for you, and prove that it is impossible (or extremely unlikely) for 2 organisms to suffer from them same 200 mutations.

(sigh) You know, if I said to someone that I could do the math, I do the math. Why won't you?
If you could do the math, then do the same math with this example I gave previously.
In the Lenksi experiment 12 separate populations of E.coli where grown and after 20.000 generations (10 years), the gene expressions of two populations where tested and compared to their ancestors. They found that 59 genes had changed in the same way independently in both populations. Here is the article
Now first show me the math that would prove that it is extremely unlikely for two lineages to suffer from the same 200 mutations across a period of 30,000,000 just like you said you could.
And then use the same calculations on this example and determine the likely hood for two lineages to suffer from the same 59 mutations across a period of 10 years. Don't worry, take your time.

Again, paternity only shows paternal relationship. But here is an report that cites several articles on genetics and more that demonstrates common ancestry.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2409108/ ]

Ok, so at the end of the day, you agree with my original point.
The science of paternity test and the science that is supposed to prove universal common ancestor are not the same. Proving one doesn´t necessary prove the other.

No, they use the same methodology, DNA comparison. The difference between them is scale like the differences between inches and miles.
Analogy.
Paternity test can only confirm relatedness on a small scale just like this can only confirm distances at a small scale.

To confirm relatedness on larger scale then paternity tests could you use the same methodology but instead one version that works on a larger scale just like to confirm distances on a larger scale then the ruler could, you use this instead.

Both the ruler and the walking wheel use the same methodology: Measuring distance, but on different scales.
Both paternity tests and the science that prove common universal common ancestry use the same methodology:
Confirming relatedness using DNA comparison, but on different scales.

 

[Nesslig20]

Re: Educating a creationist about what evolution actually is

Yes it is both a fact and an assumption, since you are clearly a disciple of Aronra, you think that “assumtions” and “facts” are mutually exclusive, but the truth is that an assumption can be an undisputed fact and still be an assumption.

Everyone, meet my master

And yes, I do think facts and assumptions are mutually exclusive things.

Assumption
noun:
A thing that is accepted as true or as certain to happen, without proof.

Fact
noun:
a thing that is known or proved to be true.

 

[Dragan Glas]

Re: Educating a creationist about what evolution actually is

Greetings,

Thank you, Nesslig20, for that very clear explanation. I'd be interested to know what's your background and/or field of expertise. And, welcome to LoR, Nesslig20!

As I explained in my earlier simple analogy, if the river is flowing *that way*, despite eddies, micro-currents, and cross-currents, then the latter are insignificant.

Kindest regards,

James

 

[Nesslig20]

Re: Educating a creationist about what evolution actually is

Greetings,

Thank you, Nesslig20, for that very clear explanation. I'd be interested to know what's your background and/or field of expertise. And, welcome to LoR, Nesslig20!

As I explained in my earlier simple analogy, if the river is flowing *that way*, despite eddies, micro-currents, and cross-currents, then the latter are insignificant.

Kindest regards,

James

Thanks for the welcome. I don't not want to tell much about my background though, I think you would understand why.
I live in the Netherlands and 21 years old, currently I'm doing college, I finished my minor biotechnology and currently am doing minor Bioinformatics. Planning to get a master in plant biotechnology, if everything goes as I want it now. So I will be not only pissing of creationists, but anti-GMO activists as well.

 

[Dragan Glas]

Re: Educating a creationist about what evolution actually is

Greetngs,

I wasn't necessarily looking for personal info, Nesslig20, just that - given your posts so far - I inferred that you've a science-oriented background, if not professionally so.

Kindest regards,

James

 

[DutchLiam84]

Re: Educating a creationist about what evolution actually is

Thanks for the welcome. I don't not want to tell much about my background though, I think you would understand why.
I live in the Netherlands and 21 years old, currently I'm doing college, I finished my minor biotechnology and currently am doing minor Bioinformatics. Planning to get a master in plant biotechnology, if everything goes as I want it now. So I will be not only pissing of creationists, but anti-GMO activists as well.

Nederland represent!

2 minors? What university are you studying at?

 

[Nesslig20]

Re: Educating a creationist about what evolution actually is

Thanks for the welcome. I don't not want to tell much about my background though, I think you would understand why.
I live in the Netherlands and 21 years old, currently I'm doing college, I finished my minor biotechnology and currently am doing minor Bioinformatics. Planning to get a master in plant biotechnology, if everything goes as I want it now. So I will be not only pissing of creationists, but anti-GMO activists as well.

Nederland represent!

2 minors? What university are you studying at?

Not yet studying at a university, just planning to. Although I don't want to say which university I'm planning to go to, just to keep most of my personal info private.