Educating a creationist about what evolution actually is.

[Rumraket]

Re: Educating a creationist about what evolution actually is

The only controversial point is weather if this discordance is statistically significant or not, but don´t worry Rumraket would provide us with a statistical equation and we would test if this discordance is significant or not.

Then do it. I dare you to do it. Power up your linux box, do a standard maximum likelihood phylogeny in PAML using 10 species, include bats and dolphins and use their cytochrome-c sequences. Then do the same using any one of those bat and dolphin proteins and then calculate the statistical significance of the incongruence.

 

[Joebob5]

Re: Educating a creationist about what evolution actually is

I haven't taken the time to figure out the keystrokes for inserting scanned photos yet, but perhaps soon I can show you some of Werner's photos of the actual fossils that Gingerich had and compare them to the photos of the plaster cast that Gingerich made, and then presented to the public. The cast is a fraud. The whale predecessor blow-hole was fraudulently created. That's not science - that's fraud.

Werner has photos of the sigmoid process on auditory bulla for the alleged pakicetus whale predecessor and for 2 different whales and a dolphin and the pakicetus sigmoid process is obviously different. But somehow - the glorious evolutions made it appear the same. That is a fraud.

Werner also has photos of Gingerich's 1980 plaster cast skull that was presented to the public in 2009 for the TV show documentary. The plaster cast was created from just a few fragments. Werner shows that subsequent finding showed that Gingerich's 1980 skull was wrong - the creature had a nose not a blowhole, and the creature had eyes on the top of it's head - not the side like a whale. Despite the fact that 2001 skull showed that Gingerich was wrong - Gingerich still showed his 1980 skull for the TV audience - and that is a fraud.

As for your challenge of Dr. Werner - I reject your claim. Anybody who uses the scientific method is a scientist, including a medical doctor.

As for your challenge of Dr. Berlinski - I reject your claim. Anybody who uses the scientific method is a scientist, including a PhD.

As for your challenge about the 50,000 adaptations that I understand Berlinski to have counter - I reject your claim. And whether the number 50,000 or 50 or even 5 - it is still mathematically impossible for the germ cell DNA to be mutated sufficiently for the adaptations to be the result of new genetic code.

 

[Mr_Wilford]

Re: Educating a creationist about what evolution actually is

Werner has photos of the sigmoid process on...

I'm gonna stop you there. The sigmoid process in fossils like Ambulocetus and Pakicetus is indeed different from whales. But in both it fits artyodactyls, which are what whales are descended from, according to the fossil record.

What people like Werner do not discuss beyond saying it doesn't look like it's there to him because the fossil is crushed (and was made painfully clear to me that it does exist by Hans Thewissen himself, the actual guy who discovered Ambulocetus) is the involucrum, which is UNIQUE to whales, and is found in both fossils.

So Pakicetus and Ambulocetus have a feature unique to whales, not found in other artyodactyls, and a part similar to artyodactyls. That screams transitional.

Also none of your guys are scientists. Their qualifications don't mean shit, and they never used the scientific method. This is are fact, and demonstrably so, because ALL OF THEM sign statements of faith saying they already chose their answer, and all evidence against their preconceived conclusion MUST be wrong. All these so called creation scientists sign these things.

THE SECOND you sign a statement of faith and say that your answer cannot be wrong, you aren't a scientist. Period. Science does not work like that, at all.

 

[Rumraket]

Re: Educating a creationist about what evolution actually is

And whether the number 50,000 or 50 or even 5 - it is still mathematically impossible for the germ cell DNA to be mutated sufficiently for the adaptations to be the result of new genetic code.

Improbable =/= impossible.

Besides, what is a "mathematical impossibility" even? Is it different from a physical or logical impossibility? If so, how? Do you even know what the words you use mean?

Additionally: Most of what you write is gibberish. It literally doesn't make sense.

What the fuck does this mean: "impossible for the germ cell DNA to be mutated sufficiently for the adaptations to be the result of new genetic code." ?

Are you somehow trying to say that a mere five total adaptations are not possible to be produced by mutations? If so, prove it. Literally, PROVE IT.

 

[Rumraket]

Re: Educating a creationist about what evolution actually is

THE SECOND you sign a statement of faith and say that your answer cannot be wrong, you aren't a scientist. Period. Science does not work like that, at all.

Agreed.

Technically the label "scientist" is not a protected title. Anyone can call themselves a scientist. But if one goes and signs or declares adherence to faith-statements such as these, then I would argue one loses the right to call oneself a scientist:

These statements PROVE that the people who agree with them have left the world of reason, logic and evidence. Here it is in their own words:

Proof that creationists are FOUNDATIONALLY biased beyond changing their minds. That FAITH has destroyed their minds:

This is how world famous christian apologist and debate William Lane Craig views the role of evidence, reason and argument in determining what is true:

"I think Martin Luther correctly distinguished between what he called the magisterial and ministerial uses of reason. The magisterial use of reason occurs when reason stands over and above the gospel like a magistrate and judges it on the basis of argument and evidence. The ministerial use of reason occurs when reason submits to and serves the gospel.... Should a conflict arise between the witness of the Holy Spirit to the fundamental truth of the Christian faith and beliefs based on argument and evidence, then it is the former which must take precedence over the latter."
—William Lane Craig, Reasonable Faith (1994), p. 36

Wait, there's more and it gets worse:

"Suppose someone had been told to believe in God because of an invalid argument. Could he stand before God on judgment day and say," God, those Christians only gave me lousy arguments for believing in you. That is why I didn't believe"? Of course not! The Bible says all men are without excuse. Even those who are given no good reason to believe and many persuasive reasons to disbelieve have no excuse, because the ultimate reason they do not believe is that they have deliberately rejected God's Holy Spirit."
—William Lane Craig, Reasonable Faith (1994), p. 37

Belief in christianity and faith makes people insane. All of this shit is fundamentally anti-science.

 

[SpecialFrog]

Re: Educating a creationist about what evolution actually is

The only controversial point is weather if this discordance is statistically significant or not, but don´t worry Rumraket would provide us with a statistical equation and we would test if this discordance is significant or not.

Then do it. I dare you to do it. Power up your linux box, do a standard maximum likelihood phylogeny in PAML using 10 species, include bats and dolphins and use their cytochrome-c sequences. Then do the same using any one of those bat and dolphin proteins and then calculate the statistical significance of the incongruence.

I don't recall saying that.

 

[he_who_is_nobody]

Re: Educating a creationist about what evolution actually is

he_who_is_nobody[/url]"]After reading Gingerich et al. (1983), I can safely say that nowhere in it is there a drawing of Pakicetus as an aquatic animal. There are only two figures in the three-page paper and all of them are of the fossils they found. The only picture in the figures that would have had any artistic interpretation to it would be this one:

However, this picture is a hypothesis of what the rest of the fossil should look like. The white outline carries no weight, except for as a prediction of what should be found. What we can see when comparing it to the new (new as in almost ten years old) discoveries is that Gingerich et al. were not to far off from their prediction.

It seems this is another Nebraska man case, where science is being blamed for the mistake of an artist.

A read of that old thread might give our new creationist a leg up on this discussion.

I haven't taken the time to figure out the keystrokes for inserting scanned photos yet,

Prolescum[/url]"]ETA:

We have a primer for using the various BBCodes (such as embedding YouTube videos) here.

 

[Mr_Wilford]

Re: Educating a creationist about what evolution actually is

THE SECOND you sign a statement of faith and say that your answer cannot be wrong, you aren't a scientist. Period. Science does not work like that, at all.

Agreed.

Technically the label "scientist" is not a protected title. Anyone can call themselves a scientist. But if one goes and signs or declares adherence to faith-statements such as these, then I would argue one loses the right to call oneself a scientist:

That picture always makes me irritable. It's part of why I seriously do not like creationists (at least the high ups). If they wanted to show flaws in evolution, fine, be my guest. If they don't dogmatically take evidence agaisnt evolution as indicative of their alternative hypothesis, then they're doing science. But creationists, specifically YECs, always take it as an either or. Either it's evolution or a Young Earth, Flood, etc. And that's pathetic.

Take notes kids. If someone signs a statement of faith such as these, then they are not a scientist, no matter what they call themselves.

 

[Nesslig20]

Re: Educating a creationist about what evolution actually is

I haven't taken the time to figure out the keystrokes for inserting scanned photos yet, but perhaps soon I can show you some of Werner's photos of the actual fossils that Gingerich had and compare them to the photos of the plaster cast that Gingerich made, and then presented to the public. The cast is a fraud. The whale predecessor blow-hole was fraudulently created. That's not science - that's fraud.
Werner has photos of the sigmoid process on auditory bulla for the alleged pakicetus whale predecessor and for 2 different whales and a dolphin and the pakicetus sigmoid process is obviously different. But somehow - the glorious evolutions made it appear the same. That is a fraud.
Werner also has photos of Gingerich's 1980 plaster cast skull that was presented to the public in 2009 for the TV show documentary. The plaster cast was created from just a few fragments. Werner shows that subsequent finding showed that Gingerich's 1980 skull was wrong - the creature had a nose not a blowhole, and the creature had eyes on the top of it's head - not the side like a whale. Despite the fact that 2001 skull showed that Gingerich was wrong - Gingerich still showed his 1980 skull for the TV audience - and that is a fraud.

I don't have to respond to this since I have corrected you on this already and someone else did it also.

I'm gonna stop you there. The sigmoid process in fossils like Ambulocetus and Pakicetus is indeed different from whales. But in both it fits artyodactyls, which are what whales are descended from, according to the fossil record.

What people like Werner do not discuss beyond saying it doesn't look like it's there to him because the fossil is crushed (and was made painfully clear to me that it does exist by Hans Thewissen himself, the actual guy who discovered Ambulocetus) is the involucrum, which is UNIQUE to whales, and is found in both fossils.

So Pakicetus and Ambulocetus have a feature unique to whales, not found in other artyodactyls, and a part similar to artyodactyls. That screams transitional.

Also none of your guys are scientists. Their qualifications don't mean shit, and they never used the scientific method. This is are fact, and demonstrably so, because ALL OF THEM sign statements of faith saying they already chose their answer, and all evidence against their preconceived conclusion MUST be wrong. All these so called creation scientists sign these things.

THE SECOND you sign a statement of faith and say that your answer cannot be wrong, you aren't a scientist. Period. Science does not work like that, at all.

As for this:

As for your challenge of Dr. Werner - I reject your claim. Anybody who uses the scientific method is a scientist, including a medical doctor.
As for your challenge of Dr. Berlinski - I reject your claim. Anybody who uses the scientific method is a scientist, including a PhD.

You must even be a bigger idiot then I thought. Using the scientific method doesn't make you a scientist. Not at all you idiot! I use the scientific method in college, but I'm not a scientist (yet at least).

Dr. Werner is a physician, not an anatomist as Gingrich is. (again who is better at plumbing the plumber or the philosopher or in this case a physician?)
Dr. Berlinski is a philosopher! (again who is better at plumbing, a plumber or a philosopher).

And wether or not these people have expertise in these fields or not is irrelevant, which I have conceded before you made you whining reply

On the topic of Berlinski - Mr. Neslig write that he's not a scientist . I say WTF does that mean?
What relevance is the label.

Why the fuck is it suddenly relevant now because you are now trying really hard to label Berlinski as a scientist!?
And I once again, called you out on your bullshit!

But again, wether or not these people have expertise in these fields is nor relevant and therefore these challenges still stand:
1. To Werner
Dr. Werner is a physician, so yeah a real expert on whale and mammal anatomy such as Gingrich is. (sarcasm)
But even that doesn't particularly matter. Dr Werner hasn't reported this mistake to the scientific community by publishing an article correcting Gingrich's fraud. Can you find any peer review article about this that Dr Werner wrote. NO. none.
All you can site is a book written by Werner which isn't a textbook like you claimed it to be.

2. To Berlinski
Which [counting 50.000 changes] he didn't do. You know how I know. Because if you where to count 1 change ever 10 seconds it takes you 5 (full 24 hour non stop) days of counting to count 50.000 changes. And in all that time, Berlinski never kept a list of the changes he counted up. And he also forgot to take into account that whales did not evolved from cows in his "critical" approach.You and Berlinski are full of shit.
And what's more. Here is an actual scientist taking a critical approach to Berlinski's claims.

"I’ve tried to do some of these calculations. The calculations are certainly, certainly not hard, but they’re interesting. I stopped at 50,000." - Berlinski.

"Think about that. I want more details of his method. So David Berlinski is sitting. He’s contemplating the cow, and he’s enumerating the changes. Does he just make a hash mark on a sheet of paper when he thinks of one? Does he make a list? He says he came up with 50,000 items, and that it was easy. Let’s see a recitation. Was one of his differences that “cow rhymes with plow, and whale rhymes with tail”? How does he know that any of his litany of changes are actually biologically relevant? And do we really believe that David Berlinski can identify that many significant biological differences between two species of mammals?
I don’t think so. You’d have to be an idiot to believe him.
Which is probably why the DI thought his interview was a worthy contribution."
- PZ Myers

And PZ Myers was right, You have to be an idiot into believing Berlinski's 50.000 changes crap.

As for your challenge about the 50,000 adaptations that I understand Berlinski to have counter - I reject your claim.

What claim? That I said he didn't counted up 50.000 changes? Do you still believe that he actually counted up 50.000 changes? Not to mention that Berlinski made the mistake of thinking that Whales evovled from cows, which they didn't.
I reject your claim that Berlinski counted up 50.000 changes. Can you give me his list. Don't bother, it doesn't exist. And we both know why it doesn't.

And whether the number 50,000 or 50 or even 5 -

Oh, no you don't! Don't you go fucking back peddling on on me and say that wether it is 50.000 or 50 or 5 is irrelevant!
You stated as fact that Berlinski counted up 50.000 changes! Now it's time for you to PUT UP OR SHUT UP!!
Either show the 50.000 list or Berlinski or admit that he is full of shit!

it is still mathematically impossible for the germ cell DNA to be mutated sufficiently for the adaptations to be the result of new genetic code.

Show the mathematical equation. Oh, who am I kidding.

 

[Rumraket]

Re: Educating a creationist about what evolution actually is

I don't recall saying that.

Thx, fixed.

 

[Rumraket]

Re: Educating a creationist about what evolution actually is

Take notes kids. If someone signs a statement of faith such as these, then they are not a scientist, no matter what they call themselves.

Not only are they not scientists. They are not mentally healthy. They're not "all there" so to speak.

In a way I feel sorry for them, they are in desperate need of guidance and therapy from a mental health professional. Something strange has happened in their heads and they have become ill with a disease of the mind. Irrationally held faith is a mental illness and it should be treated just as we should try to help and treat people who genuinely believe they're Batman, or Napoleon or a resurrected Elvis or shit like that.

 

[SpecialFrog]

Re: Educating a creationist about what evolution actually is

Really, the whole "X is / is not a scientist" is kind of silly. Even scientists have a domain of expertise and their opinions outside their domain should not be considered reliable. The two named individuals have no relevant expertise making their opinions on the matter of low value. They may still provide valid arguments based on evidence which can be assessed on their own merits.

 

[DutchLiam84]

Re: Educating a creationist about what evolution actually is

As for your challenge of Dr. Werner - I reject your claim. Anybody who uses the scientific method is a scientist, including a medical doctor.

As for your challenge of Dr. Berlinski - I reject your claim. Anybody who uses the scientific method is a scientist, including a PhD.

I'm using tools, therefor, I am now a car mechanic, a plumber, a carpenter, an engineer, a surgeon etc.

I have books, therefor, I am a writer, a librarian and I am amazon.com.

I have a Bible, that I've read, so now I'm a pastor, a Bible expert and I'm the pope.

I have alcohol, so I'm a distiller!

I have a watering can, therefor, I'm a botanist and a gardener.

Holy shit, I'm an expert in pretty much anything according to you, my CV is amazing!



I wish life was this easy Joebob5. Sadly, it doesn't work like that.

 

[Collecemall]

Re: Educating a creationist about what evolution actually is

I reject your rejection of all claims. See how easy that is?

 

[SpecialFrog]

Re: Educating a creationist about what evolution actually is

I have a Bible, that I've read, so now I'm a pastor, a Bible expert and I'm the pope.

You're the Pope too? What a coincidence.

 

[he_who_is_nobody]

Re: Educating a creationist about what evolution actually is

I reject your rejection of all claims. See how easy that is?

 

[Nesslig20]

Re: Educating a creationist about what evolution actually is

Just to further demonstrate, in greater detail, Leroy's Error but also correcting myself:

"Ecolocation in bats and dolphins is almost identical even at a molecular level (same proteins same genes)"
"if you what to argue that convergent evolution took place, you would have to argue that 2 independent clades suffer from the same mutations 200 independent times."

What he doesn't understand is that one, the Echolocation of bats and dolphins is NOT identical, because bats and dolphins use different mechanisms of generating and emitting sound waves. They do receive the echo the same way, by their hearing which was inherited from their common mammal ancestors.
And it is NOT identical at the molecular level. Which I have demonstrated here with comparing the nucleotide sequences of prestin genes of both Echolocating bats and dolphins as well as their close relatives:

I looked that the citation you provided, but nowhere does it say that the genes where identical, nor in the original article.
The only similar statement that it said was:
"in 2010, Stephen Rossiter, an evolutionary biologist at Queen Mary, University of London, and his colleagues determined that both types of echolocating bats, as well as dolphins, had the same mutations in a particular protein called prestin, which affects the sensitivity of hearing. Looking at other genes known to be involved in hearing, they and other researchers found several others whose proteins were similarly changed in these mammals."

Notice that it doesn't say that the proteins and genes are identical. The mutations where identical and they happen in the same genes. Prestin in particular which is involved in hearing, not surprising since both bats and dolphins use hearing in echolocation.

But the genes as a whole are not identical. Let me demonstrate.
I took the nucleotide sequences of the prestin genes of both echolocating bats and echolocating dolphins and compare it with the sequences of their relatives that don't echolocate. You can do this too using NCBI blast.

Let's do this science style.
Question: What are the relationships between the gene sequences of the gene prestin of echolocating animals (certain bats and dolphins) and their close relatives.
Hypothesis 1 (common ancestry): Even though prestin of dolphins and certain bats contain similar changes as an adaptation towards echolocation, the relationship between them and their relatives should still follow the model of common ancestry. The prestin of echolocating bats should be more similar to that of non-echolocating bats and that of dolphins should be more similar relatives like other Cetaceans that don't echolocate.
Hypothesis 2 (Identical at the molecular level, same proteins same genes): Since prestin is identical in both echolocating bats and dolphins, they should be more similar to each other, even more then sequences of those that are supposedly more closely related to them than either one are to each other.
Data:
Prestin cDNA sequences of:
1. Echolocating animals
- Bottlenose Dolphin
- Little brown bat
2. Non echolocating animals
Close relative of dolphins:
- Mink whale
Close relative of echolocating bats:
- Large Flying Fox
Methods: NCBI blast
Results:
1 Close relative comparisons (echo locators on their non echo locator relative).
- Bottlenose Dolphin / Mink whale = 97% match
- Little brown bat / Large flying fox = 93% match
2. Echolocators comparisons
- Little brown bat / Bottle Nose dolphin = 92% match
Conclusion:
There is a closer match between the echo locators and their close relatives then there is between the echo locators themselves, which was expected by the hypothesis based on common ancestry.

I also have explained that those 200 identical mutations he talked about, likely weren't identical mutations. The paper he cited mentioned that both echolocating bats and dolphins had 200 identical amino acid substitution in genes involved in hearing and also in vision, which could be explained that an adaptation toward echolocation makes acoustic information translated into sight, forming an actual visual image based on the sounds the brain receives, a form of synesthesia like Richard Dawkins once mentioned, and a study with brain scans of blind people detected activity in the area of the brain associated with vision and the blind people self describe their echolocation sense as a visual image. Thus this depiction of how it literally LOOKS like to experience echolocation could be more accurate then it may seem.

Moving on, identical amino acid substitution doesn't mean identical mutations where the cause of this. Different mutations effecting different sequences of DNA can result in also different sequences of DNA but the effect it has on the protein in both cases can be the same as I explained here:

Genes code for protein, but you must know how. Without to many details, genes have codons, which are 3 nucleotides like A-T-G. Each codon codes for one amino acids. ATG in particular codes for methionine or Met for short.
There are 20 amino acids and there are (4x4x4) 62 possible codons. This results in severe redundancy, where two or more codons code for the same amino acid.
For example, codons:
CGT
CGC
CGA
CGG
AGA
AGG
All code for Arginine or Arg.
These two very different DNA sequences still produce the same protein:
1. ATGCGTCGACGGCGCCGTCGACGGCGCTAA
2. ATGAGAAGGAGAAGGAGAAGGAGAAGGTAA
Protein: Met-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg
Now we come back to the question, how can different mutation result in the same effect? Well let's take one example.
If you start with this codon:
TGG
(which codes for Tryptophan)
and mutate it into codon
AGG
by replacing the T with A you get a codon that codes for Arginine.
You can also do it in another way.
TGG
replacing T with C
CGG
Also encodes for Arginine. Thus you have now two different mutation that results in the same thing.
You can also start with different codons each having different mutations that make different codons, but will still result in the same thing.
TGT (= Cysteine) [replace T with C] CGT (=Arginine)

ACA (=Threonine) [replace C with A] AGA (=Arginine)
In fact, if you do the calculations, the number of possibilities of changing any that don't code for Arginine into any codon that does (by just one substitution mutation replacing one nucleotide by another) = 36
There are 36 possibilities that will change one codon which doesn't code for Arginine into one that does. And this is just by one substitution mutation. If you would calculate the possibilities with multiple mutations allowed, the possibilities would just increase even further.
Chances are that those "same 200 mutations" were not the same. They could be very different mutations that resulted in the same effect, changing different codons into also different codons that code for the same amino acid.

But how can we know for certain that the mutations echolocating bats and dolphins resulting in the same amino acid substitutions where in fact different? Well, science duh!
First we compared the nucleotide sequences of the prestin genes of echolocating bats and dolphins and got this result.
1 Close relative comparisons (echo locators on their non echo locator relative).
- Bottlenose Dolphin / Mink whale = 97% match
- Little brown bat / Large flying fox = 93% match
2. Echolocators comparisons
- Little brown bat / Bottle Nose dolphin = 92% match
Thus based on nucleotide sequences, prestin of echolocating bats and dolphins are more similar to their relatives then to each other, consistent with common ancestry. This already tells you that Leroy was wrong about the genes being almost identical and inconsistent with common ancestry, but it doesn't mean that echolocating bats and dolphins didn't experience identical mutations. In order to determine that we need to compare the proteins themselves. I did it with NCBI protein blast with using the amino acid sequences of the prestin proteins with the same animals (click on the names of the animals to see the sequences)
Data:
Prestin cDNA sequences of:
1. Echolocating animals
- Bottlenose Dolphin
- Little brown bat
2. Non echolocating animals
Close relative of dolphins:
- Mink whale
Close relative of echolocating bats:
- Large Flying Fox
Methods: NCBI protein blast
Results:
1 Close relative comparisons (echo locators on their non echo locator relative).
- Bottlenose Dolphin / Mink whale = 96% match
- Little brown bat / Large flying fox = 94% match
2. Echolocators comparisons
- Little brown bat / Bottle Nose dolphin = 93% match

As you can see, even the proteins are more similar between the close relatives of the echo locators than between that of the echo locators themselves, once again consistent with common ancestry. But just because most of the protein of echolocating is more similar too that of close non-echlocating bat relatives than it is too echolocating dolphins, doesn't mean that at a few locations of the proteins of both echolocating dolphins and bats are more similar than with their close relatives. Those are the same amino acid substitutions the article identified in the genes of echolocating dolphins and bats. We can look for those by aligning the amino acid these sequences. I used Clustal Omega.
The alignment I got was this right here.
The only error the program made was at the end all four proteins have amino acids: P - E - A
But aren't aligned because one of them has amino acid Q before these last three, but they actually should be aligned. Often the programs fails to correctly align the ends of the sequences, but it is nothing of a nuisance.
The first think when seeing the alignment, you are likely to notice a great similarity between all the proteins. In fact all proteins are about 740 amino acids long and of those 740 amino acid, (672=) 91% are identical across all species. Most of the amino acids that differ are more similar to close relatives like. For example at amino acid 39, both bats have an P and Cetaceans have an S. But we are not interested in those, we want to see where those that echolocate are the same but different from there relatives. I made list where those are the same in echolocating animals: The numbers give the positions in the alignment.

7 - 308 - 393 - 566
4 positions in total.

Now we can make predictions. If different mutations can result in different codons that code for the same amino acid, thus an identical amino acid substitution in two separate lineages could very likely be caused by two different mutation resulting in different codons but still producing the same amino acid, we should see the some of the codons that encode the amino acids of these 4 positions above be different codons (except for those amino acids that only one codon can encode). We can also calculate the chance of this happening by comparing to their relatives we can see how they differ. For example if the echolocates use codons
CGT and AGG for amino acid R, we should expect the relatives to have similar codons but coding for different amino acids. like relative of CGT is GGT and relative of AGG is TGG.
And we can calculate that. If you calculate just by chance alone, just one substitution mutation like those previous has a 1/3 chance to happen in a particular nucleotide (because in a codon there are just 3 nucleotide) and a 1/3 chance to change A in T (because A can only change in T, G or C). Thus one substitution mutation has 1/9 chance of happening.

And we should expect of those codons that are identical, should be also nearly identical to the codons of the close relatives use. For example both echolocating dolphins use codon AGT for coding amino acid S and their close relatives should have a similar codon like one nucleotide different like TGT which codes amino acid C. Which in this case, means that both echolocating bats and dolphins only need to have one identical mutation, which isn't unlikely. However if they do use the same codon, like AGT but their close relatives have a very different codons like TCA in the same place, which means both lineages must have three identical mutations, which isn't as likely.
We can calculate the changes of this too. If you calculate just by chance alone, the substitution mutation like AAA to TAA has a 1/3 chance to happen in a particular nucleotide (because in a codon there are just 3 nucleotide) and a 1/3 chance to change A in T (because A can only change in T, G or C). Thus one substitution mutation has 1/9 chance of happening. One identical happening twice is 2 times in two lineages is 1/81.
And two substitution mutations happening in one codon like AAA to TTA is 1/54 and that happening twice independently is 1/2916. And three substitution mutations happening like AAA to TTT is 1/162 and this happening twice is 1/26244.

Thus we can calculate what the highest possible chance is to get 4 identical amino acid substitutions.
The highest chance is to get one identical amino acid substitution:
For example lineage one changes codon GGT to CGT and the other TGG to AGG resulting two lineages acquiring different codons but still the same amino acid is. This requires two substitution mutations thus the chance is 1/81 of this happening. Thus the highest chance for these 4 amino acid substitution is (1/81)^4 =
1 in 43046721 Seems very low but this is the highest possible chance and it's very high to the next chance calculation.
The absolute lowest chance of for example changing in one lineage AAA to TTT and in another GGG to TTT is 1/26244 and this happening 4 times is 1 in 2,2503E+35.
This chance is almost 10000000000000000000000000 times lower then the highest possible chance.
We should expect, based on common ancestry, to get a calculation that is very close to the one with the highest chance possible.
Okay, lets do this, I looked up at each of the 4 positions and looked up which codons the echo locators used using Codon alignment program online. Are they the same or are they different and how similar are they compared to their close relatives?
7: Codon of echo locators left and their relative right:
ACT - AAT
ACT - AAT
Identical codon, however as expected with identical codons, the codons of the close relatives are also identical and just one nucleotide different.
Chance = 1/81
308: Codon of echo locators left and their relative right:
AGC - AAC
AGC - AAC
Identical codon, however as expected with identical codons, the codons of the close relatives are also identical and just one nucleotide different.
Chance = 1/81
393: Codon of echo locators left and their relative right:
GCA - TCA
GCA - TCA
Identical codon, however as expected with identical codons, the codons of the close relatives are also identical and just one nucleotide different.
Chance = 1/81
566: Codon of echo locators left and their relative right:
TTC - CTC
TTT - CTC
Not identical codons, thus two lineages managed to get codons that code for the same amino acids by different mutations, however, one codon is two nucleotides different and the other just one, 3 in total, which decreases the chance.
Chance = 1/729
It is true that I did not expect to find 3 out of 4 identical mutations happening. That's an error on my side. However, the reason for that many identical mutations is easily accounted for because the corresponding codons of closely related organism are so identical that the easiest way to get a codon for the same amino acid is by having the same substitution mutation. Thus this doesn't negate common ancestry as this calculation should show.
The chance of this in total is 1/81 x 1/81 x 1/81 x 1/729 = 1 in 387420489
Which is much closer to the highest possibility of 1 in 43046721, then it is to the lowest possibility of 1 in 3,42594E+32
Thus in conclusion, the substitution mutations is what we would expect by common ancestry taken into account that close relatives have identical codons.

 

[leroy]

Re: Educating a creationist about what evolution actually is

No, I can also say that you are equivocating by trying to pretend that similarities in proteins means genetic similarities (which is what you claimed above). Moreover, you are trying to pretend that common ancestry inherently predicts a certain hierarchy of proteins produced by organisms. .

No, obviously I am aware of the fact that the common ancestry model would predict some discordances (or mismatches) the common ancestry model doesn’t predict a perfect nested hierarchy.

All I am asking for is a model that would tell us if a discordance is significant or not, a model that would tell us at what point would common ancestry be
refuted (or questioned) given a certain number of discordances.

Rumraket will soon provide this model; we simply have to be patient.

It has been pointed out to you repeatedly that if you look at the genes that produce the proteins you are talking about you do not see the discordance above. The wording of your argument suggests you accept this (though you seem reluctant to admit it).

Yes in fact the article on echolocation is referring to genes that code for the proteins, so when I mentioned “proteins” I really meant the genes that code for those proteins.

These genes, that code for proteins that are present in all mammals, are more similar in bats and dolphins than in dolphins and other cetaceans, (those cetaceans that do not use echolocation)
This is obviously a miss match in the nested hierarchy pattern since dolphins are supposed to be more closely related to other cetaceans than to bats.

Quote from the article:

analyses of convergent sequence evolution in 805,053 amino acids within 2,326 orthologous coding gene sequences compared across 22 mammals (including four newly sequenced bat genomes) revealed signatures consistent with convergence in nearly 200 loci. Strong and significant support for convergence among bats and the bottlenose dolphin was seen in numerous genes linked to hearing or deafness, consistent with an involvement in echolocation. Unexpectedlyhttp://www.nature.com/nature/journal/v502/n7470/abs/nature12511.html

The article is referring to “convergence” at a genetic level, not at a supertall level.

Particularly the article mentions 200 loci where this discordance takes place. Therefore if you “what to argue convergent evolution” you are arguing that 2 independent clades had the exact same mutations in the exact same proteins 200 times

Is this statistically possible? Well we don´t know, we have to wait until rumarket presents his statistical method.

Nesling is correct in pointing this:

But the genes as a whole are not identical. Let me demonstrate.
I took the nucleotide sequences of the prestin genes of both echolocating bats and echolocating dolphins and compare it with the sequences of their relatives that don't echolocate. You can do this too using NCBI blast.

Sure the genes as a whole, are probably consistent with the nested hierarchy pattern however it is still a fact that there are discordances in portions of these genes, and the problem remains the same:
You have to prove that it is statistically possible to get 200 identical mutation in the same proteins mutations in 2 independent clades. (well actually the article mentions 3 clades but let’s keep it in 2)

 

[leroy]

Re: Educating a creationist about what evolution actually is

I've also noticed a theme here. These are some of your statements that I've corrected.

1. Statement: "The fact that we share some percentage of DNA with chimps doesn’t prove that we are related"
Correction: Genetic similarity does prove relatedness, we use it in paternity tests.

Grated, my only objection on this is that design hypothesis would also predict genetic and anatomical similarities.

Design would predict that similarities, possible and expected

Common ancestry would predict similarities and a nearly perfect nested hierachy

2. Statement: "First of all, paternity test can only tell you if someone is your father or mother, and with a low degree of certainty."
Correction: Paternity tests can be 99.99% reliable and if you have a son, father and grandfather. You can use two paternity tests (one on son and father and another one on father and grandfather) to demonstrate son and grandfather relationship with 99,98% reliability.

Ok wrong wording on my side, What I was trying to say is that paternity test can tell you if someone is your father and with a lower degree of certainty if someone is your grandfather.

My only point was that son-father test are more reliable than grandfather-grandson test, (but both tests are reliable)

3. Statement: "no judge would ever accept a paternity test for a great grandfather."
Correction: Judges Do accept the validity of paternity tests.

You didn´t read my comment, I said that no judge will ever accept a “grate grand parent---grate grand son test” after 2 generations the test becomes unreliable,

You could argue that after 3 or 4 generations the result are still more less reliable, but not after millions of generations.

4. Statement: "Paternity test are based on the assumption that our genes are a combination of mom and dad"
Correction: The fact that we inherit DNA from our parents is NOT an assumption you idiot!

Yes it is both a fact and an assumption, since you are clearly a disciple of Aronra, you think that “assumtions” and “facts” are mutually exclusive, but the truth is that an assumption can be an undisputed fact and still be an assumption.

5. Statement: "the science of paternity tests and the science that is supposed to prove universal common ancestry are not the same"
Correction: They are since both rely on Genetics and use DNA comparison of genetic homology. The only difference is scale, as in the difference between inches and miles.

Ok, with paternity test I am assuming that you are talking about those tests that use restriction enzymes to cut DNA, if you are retiring to other type of paternity test please let us know exactly to what paternity test are you talking about.

With that said, please provide an article that proves that humans and chimps share a common ancestor, where the researches used restrictions enzymes to cut DNA to determine that chimps and humans are related.

The researches have to use the same method used in paternity tests.

Please provide the article, please do not provide an article about an unrelated topic, you have to show an article that proves common ancestry using restriction enzymes..

6. Statement: "Ecolocation in bats and dolphins is almost identical"
Correction: Echolocation involves generating and emitting sound waves and receiving the echo. Bats generate sound with their larynx and emit sound via their open mouth or nostrils. Dolphins generate sound by passing air from the bony nares through the phonic lips and emit it by reflecting the sound waves by the thick concave bone of the cranium and the sound is modulated by the fatty organ called the 'melon'. Very different mechanisms of echo location. The only identical thing about their method of echolocation is they use hearing to receive the echo, and guess what, both bats and dolphins inherited hearing from their common ancestor.

Ok, I apologize for that, I overestimated the implications of the article about echolocation, the article does not sat that echolocation in bats and dolphins is identical, (that statement has never been proven nor disproven)

What the article says is that bats and dolphins are identical in 200 loci where closer relatives have differences.
But it is still a fact that if you what to argue convergent evolution, you have to prove that it is statistically possible to get 200 mutation in the exact same protein in the exact same loci in 2 independent clades.

7. Statement: "identical even at a molecular level"
Correction: One gene in particular, called prestin, that is involved in echolocation of certain bats and dolphins, which your own citation gave, are more similar in their close, non echo locating, relatives than between them. Not identical.

Yes that is true, the gene perstin as a whole forms a consistent nested hierachy, but there are some portions of this protein where the nested hierchy pattern is broken.

And it is still a fact that your model requires that 2 independent clades suffered from the same mutation independently, you have to prove that such an event is statistically possible.

Do you honestly admit your errors and accept the correction?

Yes I made some minor mistakes, but you still have two challenges

1 prove that it is possible to get 200 mutations in 2 independent clades(obviously this mutations have to survive natural selection and genetic drift)

2 provide an article that proves the common ancestry model USING THE SAME METHOD, used in paternity tests.

 

[leroy]

Re: Educating a creationist about what evolution actually is

But you don´t have unlimited time, cetaceans that use sonar where suppose to diverge from those who doesn´t use sonar 30,000,000 years ago.
Is 30,000,000 years enough time?

But bats and dolphins aren't of course THAT distantly related, so in this case the question becomes if 200 mutations showing bats and dolphins as more closely related, than the rest of their genes, is enough to represent a statistically significant incongruence

Ok, but how do you know that 200 is not an issue? Show me your math.
What if instead of 200 there where 300 or 400 or 1,000 at what point would you say that the discordance is significant, please show me your statistical model.