Educating a creationist about what evolution actually is.

[SpecialFrog]

Re: Educating a creationist about what evolution actually is

Inferno is just playing semantics; the fact is that bats and dolphins have genetic similarities that were not expected. And that can´t be explained with common ancestry.

Someone whose arguments are roughly 90% semantics should probably not accuse others of playing semantics. Also, did you read that thread or did you just remember it from when you used to be dandan?

Besides, the argument quoted is hardly semantic. Do you recognize that there is a difference between different DNA strands producing similar proteins and similar DNA strands?

 

[Rumraket]

Re: Educating a creationist about what evolution actually is

On a related note, the popular-press author of that article is a well-known crapwriter. Simply put, she is famous for exceedingly severe misrepresentations of the science she reports on. Google her name "Elizabeth Pennisi" and "Sandwalk" and you can see some gruesome examples.

It should come as no surprise she's wildly popular on IDcreationist websites. It's almost like she writes articles explicitly with the purpose of serving as ammunition for IDcreationists.

Weather if there are true chimeras or not is irrelevant for the conversation that we are having, you are supposed to provide an statistical method that would tell us if a discordance is significant or not.

¿Are you going to present your statistical model yes or no?

It isn't "my" statistical model. And it has already been presented. Go read the entire article in the link I gave.

Edit: fixed link.

 

[Rumraket]

Re: Educating a creationist about what evolution actually is

I was able to show that the similarities occur in the amino acid sequences, something that's perfectly understandable. I think I even explained at some point that "identical amino acids" in no way mean "identical nucleotide sequences". Do you even understand the difference between the two?

Codons code for amino acids, meaning three nucleotides in a row. Take the amino acid Leucine: TTA, TTG, CTT, CTA, CTG, CTC all code for it. If we have the amino acid sequence LLLLLL, we may have any of the six codons coding for them. Suppose that bats and dolphins both have the same amino acid sequence "LLLLLL". The bats may have the codon sequence CTCCTCCTCCTCCTCCTC, while dolphins may have the sequence TTATTATTATTATTATTA. Both code for the same amino acid sequence (LLLLLL), but they're not identical, would you agree? It would therefore be idiotic to claim that the two could only arise by the exact same mutations, would you agree?

Inferno is just playing semantics; the fact is that bats and dolphins have genetic similarities that were not expected. And that can´t be explained with common ancestry.

There is no semantics at play here. Statistically speaking there is an enormous difference between having the same amino-acid substitutions in key locations in some of your proteins, versus having the exact same nucleotide sequence in your protein-coding genes.

Everything he said is unambigously correct and goes straight at the heart of the matter, which is the degree to which an account relying on convergent evolution can rationally explain a case of so-called 'chimerisms' in two separate species that did not inherit that system from a common ancestor.

And you have in fact been given the statistics used to evaluate incongruent phylogenies. You should now proceed to learn about and understand it, rather than pretend it has not been provided. Read the links given.

 

[Nesslig20]

Re: Educating a creationist about what evolution actually is

The problem is that true chimeras have been found.

For example Echolocation is bats and dolphins.

Bats and dolphins both devolved a complex system of echolocation. You can´t explain this with common ancestry because bats and dolphins are not close relatives and their common ancestors was a mammal without a system of echolocation.
This means that dolphins and bats developed this ability independently.

Yes, it's called convergent evolution. Where two different lineages independently evolve features that have the same function.
I guess, I should have informed you about it earlier. I don't know why you didn't use this as an example of convergence.

All three animals (one extinct of course) use essentially the same bones in the structure of their wings: Humerus, ulna, radius, etc.
And I expect, because they use the same bones, similar genes would be involved in building their wings. However, there are notable differences.
Birds use three finger bones (now fused together) and their wings use feathers.
Bats use four finger bones as the frame of the wing which uses a membrane, with the "thumb" sticking out the wing.
Pterosaurs used a ridiculously elongated pinky finger to support their wing membrane, but the membrane, though similar looking, was very unlike the membranes of bats. The really advanced pterosaur had membranes full of various fibers including muscle, such that they had an incredible flight control. Some even had resperatory air sacs extending from cavities inside their bones into the wing membranes.
Even though they use the same bones, which they inherited from their common ancestor, for their wings, they modified those bones into wings by different means, which doesn't matter, as long as it works.
In order to fly, it requires several things like being light weight and have wings: thin airfoil-, streamlined structures with a large surface area that can produce the necessary lift. Which is what all these three examples did develop, but again by different means.
Similar (analogous) things can evolve independently, but not identical things
Thus this doesn't violate phylogeny. As with the echolocation of bats and dolphins, which I will explain next.

Ecolocation in bats and dolphins is almost identical even at a molecular level (same proteins same genes)
Finding two unrelated animals with echolocation is as bad as finding a horse with feathers.

Not quite as bad, which I will explain in a moment. But first addressing your claims:
1 "Ecolocation in bats and dolphins is almost identical"
2 "even at a molecular level (same proteins same genes)"

#1 Let's look at how the echolocation of bats and dolphins work.
In order to echo locate you need two basic things. One, the ability to generate and emit sound waves and two receive the echo it produces. Again, how you manage to do this, doesn't matter.
Bats generate ultrasound with their larynx and emit it through their open mouth or in some cases their nostrils.

Dolphins on the other hand produce their sound by passing air from the bony nares through the phonic lips. The sound is reflected by the animals thick concave bone of the cranium and the sound is modulated by the fatty organ called the 'melon' almost like an acoustic lens, focussing the sound waves in one direction.

Very different mechanisms for generating and emitting sound. Although receiving the echo is the same. They use their ears, which they did inherited from a common ancestor.
Starting to see a pattern here?

Note that the only thing you need to echolocate is emitting sound and receiving echo. You might ask, we can do both so why can't we echolocate. Well surprisingly we can, people who are blind often learn to echo locate and in some extreme cases blind from birth just develop the skill naturally, but we suck at it compared to those that can emit much more sound and have very sensitive hearing.


The key is sensitive hearing and all mammals have this trait because they have an inner ear structure with unique auditory ossicles that can pick up sounds almost no other group of tetrapods can, which evolved in the ancestors of mammals.

Once again, common ancestry, which is why almost all echolocating animals are mammals and the ones that are really good at it are all mammals. But it is still amazing that humans can echolocate like the superhero daredevil (the real batman). People like the one in the video actually report a description of their echo sense as visual patterns. And brain activity of these people support that they process auditory information to produce a visual image, a form of synesthesia that makes sound translated into sight and we all have the potential to do that.

Too bad our feet aren't sensitive enough for echolocation, because that would've been awesome.

#2: Almost identical at the molecular level (same proteins same genes).
I looked that the citation you provided, but nowhere does it say that the genes where identical, nor in the original article.

The only similar statement that it said was:
"in 2010, Stephen Rossiter, an evolutionary biologist at Queen Mary, University of London, and his colleagues determined that both types of echolocating bats, as well as dolphins, had the same mutations in a particular protein called prestin, which affects the sensitivity of hearing. Looking at other genes known to be involved in hearing, they and other researchers found several others whose proteins were similarly changed in these mammals."

Notice that it doesn't say that the proteins and genes are identical. The mutations where identical and they happen in the same genes. Prestin in particular which is involved in hearing, not surprising since both bats and dolphins use hearing in echolocation.

But the genes as a whole are not identical. Let me demonstrate.
I took the nucleotide sequences of the prestin genes of both echolocating bats and echolocating dolphins and compare it with the sequences of their relatives that don't echolocate. You can do this too using NCBI blast.

Let's do this science style.

Question: What are the relationships between the gene sequences of the gene prestin of echolocating animals (certain bats and dolphins) and their close relatives.

Hypothesis 1 (common ancestry): Even though prestin of dolphins and certain bats contain similar changes as an adaptation towards echolocation, the relationship between them and their relatives should still follow the model of common ancestry. The prestin of echolocating bats should be more similar to that of non-echolocating bats and that of dolphins should be more similar relatives like other Cetaceans that don't echolocate.

Hypothesis 2 (Identical at the molecular level, same proteins same genes): Since prestin is identical in both echolocating bats and dolphins, they should be more similar to each other, even more then sequences of those that are supposedly more closely related to them than either one are to each other.

Data:
Prestin cDNA sequences of:
1. Echolocating animals
- Bottlenose Dolphin
- Little brown bat

2. Non echolocating animals
Close relative of dolphins:
- Mink whale
Close relative of echolocating bats:
- Large Flying Fox

Methods: NCBI blast

Results:
1 Close relative comparisons (echo locators on their non echo locator relative).
- Bottlenose Dolphin / Mink whale = 97% match
- Little brown bat / Large flying fox = 93% match

2. Echolocators comparisons
- Little brown bat / Bottle Nose dolphin = 92% match

Conclusion:
There is a closer match between the echo locators and their close relatives then there is between the echo locators themselves, which was expected by the hypothesis based on common ancestry.

So you challenge is:
¿how do you explain echolocation in bats and dolphins? And whatever explanation that you provide, ¿what can´t that explanation could be used to explain feathers in horses?
¿what is fundamentally different between horses with feathers and bats with “dolphin-like echolocation”?

The difference is that horses with feathers have actual feathers, identical to those of the feathers of birds.
Bats don't have dolphin echo location, which is why you said "dolphin-like" instead.

And note that echo location requires only the ability to make sound waves and sensitive hearing to detect the echo, which even humans who usually don't echolocate still have and with training can even develop a weak form of echolocation. Feathers on the other hand require allot more then that. Feathers you see on flying birds are a highly complex structure that evolved through several sequential stages of development over a span of over a hundred and fifty million years.

Now, different types of animals have independently evolved different types of eyes which are unique to that lineage (again, concordant with common ancestry), like vertebrates have their unique type of eye with the blind spot and all Cephalopods have their unique eye structure.

You will never find a Vertebrate with a Cephalopod eye or vise versa. Isn't that odd?

And you also can have similar mutations occurring within similar genes that have similar effects independently in different lineages, however (in the case of feathers) such a precise alignment of this sequence with these particular developments over such a long period of time, could not have evolved twice. Fully developed flight feathers are a one time occurrence. They have first appeared in theropod dinosaurs and were inherited by birds and are exclusive to this group.

 

[he_who_is_nobody]

Re: Educating a creationist about what evolution actually is

Inferno is just playing semantics; the fact is that bats and dolphins have genetic similarities that were not expected. And that can´t be explained with common ancestry.

:lol: / :facepalm:

I was able to show that the similarities occur in the amino acid sequences, something that's perfectly understandable. I think I even explained at some point that "identical amino acids" in no way mean "identical nucleotide sequences". Do you even understand the difference between the two?

Codons code for amino acids, meaning three nucleotides in a row. Take the amino acid Leucine: TTA, TTG, CTT, CTA, CTG, CTC all code for it. If we have the amino acid sequence LLLLLL, we may have any of the six codons coding for them. Suppose that bats and dolphins both have the same amino acid sequence "LLLLLL". The bats may have the codon sequence CTCCTCCTCCTCCTCCTC, while dolphins may have the sequence TTATTATTATTATTATTA. Both code for the same amino acid sequence (LLLLLL), but they're not identical, would you agree? It would therefore be idiotic to claim that the two could only arise by the exact same mutations, would you agree?

[Emphasis added]

Hopefully that image and the emphasis in the above quote will allow this very simple concept to sink in.

Creationists really need to stop hoarding debunked arguments. What is next? Nebraska Man or flash frozen mammoths?

That's would only be true if the creationists cared about the arguments being correct rather than only caring about them being superficially convincing. While there are still people out there who haven't seen them and don't know what's wrong with them they can still be re-used if you've been hoarding them carefully.

leroy[/url]"]Weather if there are true chimeras or not is irrelevant for the conversation that we are having, you are supposed to provide an statistical method that would tell us if a discordance is significant or not.

¿Are you going to present your statistical model yes or no?

The bat/dolphin claim was an argument for Nesslig20 and I will wait for his response before commenting on this particular point.

It appears you are onto something, SpecialFrog. Notice how dandan leroy refuses to argue this with someone he has dealt with before. Instead, he is trying to use it on a new person in the hopes they have never seen it before. However, that did not work either, because Nesslig20 just crushed it.

 

[Joebob5]

Re: Educating a creationist about what evolution actually is

I say change the forum title to "Convincing an evolutionist that has been indoctrinated". Or, "Evolution is a fantasy". Here's a possible title "Although they wear lab-coats, evolutionism is not a science".

Yes, I say Gingerich perpetrated a Piltdown-type fraud on the fossils at the U. Michigan. The skulls were faked to support evolutionism. And contrary to what My esteemed colleague Mr. Neslig wrote, the inner ear bones did NOT resemble pinaped structures. Dr. Werner showed photos of the actual fossils in his textbook and demonstrated that Gingerich and his studen Thewissen misrepresented the fossils and concocted a whale evolution fantasy.

And I see zero explanation why a fish would evolve to walk on land and become some sort of mammal and then decide to re-evolve and go back into the ocean. There no proof of either schemes as far as I know - the whale evolution cartoon is just propaganda device to get people to believe the fantasy without seeing proof.

On the topic of Berlinski - Mr. Neslig write that he's not a scientist . I say WTF does that mean? What relevance is the label. Is a scientist more - or less - credible than a philosopher? Of course not. Berlinski considered the whale evolution fantasy from a critical approach and claims to have counted 50,000 different anatomical and physiological adaptations that would be necessary for a land creature to become a whale. That sound fine to me - the skin, the tail, the teeth, hemoglobin, eyes, ears, you name it. Each of those 50,000 adaptations requires multiple genetic mutations and each mutation must be non-lethal or Beneficial. And the location of each genetic mutation is random. Selective pressure does not occur until the mutation is expressed, but the occurrence of the mutation is random. Now do the math - roughly. There are perhaps 1 trillion cells in the typical land creature? And only 1 germ cell - so the probability of a germ cell mutation are 1 chance in a trillion. And with each germ cell there are perhaps 1 billion base pairs. So the total chance of a base pair mutation in a germ cell within a land creature is 1 chance in a billion-trillion. And you need that 1 chance to occurs 50,000 times in order to get all the adaptations. So your probability is impossible. Somewhere around 1 chance in 10*100.

AND it needs to occur in both sexes. AND both sexes of the mutated subject must mate - they must grow up together.

It's impossible.,

 

[Isotelus]

Re: Educating a creationist about what evolution actually is

....Really?

.......Really? This again? Why? Just...why? (Okay, I know why, but the question still stands, because really, it needs to)

Inferno is just playing semantics; the fact is that bats and dolphins have genetic similarities that were not expected. And that can´t be explained with common ancestry.

Plenty of people here are dealing with all of this nonsense wonderfully, but I just want to reiterate what others have already stated. Semantics deals with the meanings of words. But none of what Inferno (or anyone else here, for that matter) said is semantics; it's an education. You're collapsing it into word stuff and therefore diverting any responsibility of having to meaningfully and adequately address the issue away from yourself. If anyone's playing here, it's you.

leroy[/url]"]Weather if there are true chimeras or not is irrelevant for the conversation that we are having, you are supposed to provide an statistical method that would tell us if a discordance is significant or not.

¿Are you going to present your statistical model yes or no?

The bat/dolphin claim was an argument for Nesslig20 and I will wait for his response before commenting on this particular point.

Clearly, the multitude of statistical models that were presented in this thread and others have been ineffective (possibly ignored?). Clearly, the gun has been jumped. I've mentioned this elsewhere: you need to know the basis for discordance and what the models are working off; i.e. how the tree that is recovering relationships based on molecular or morphological data was actually generated. I have yet to see any indication that you know how hierarchical trees are produced; otherwise you wouldn't have failed to see the extremely obvious relevance in what Rumraket posted to you about phylogenetics. It's the same problem I mentioned above. You can't keep on brushing off the fundamentals while demanding people to do the dirty work for you on a topic that you can't see has any relations to anything else. You just can't. It's not working, and this whole discussion will continue to go absolutely nowhere. Read the links that people are posting, and then maybe try to find your own statistical models for a change. They are there in abundance, and some are even open access.

 

[Nesslig20]

Re: Educating a creationist about what evolution actually is

Hey everyone, this is the guy I was talking about, he has finally come over here.

I say change the forum title to "Convincing an evolutionist that has been indoctrinated". Or, "Evolution is a fantasy". Here's a possible title "Although they wear lab-coats, evolutionism is not a science".

First sentence in the forum and already huffing, puffing and pointless posturing. And also nagging about the title. The reason for the title is that I've been trying to teach you what evolution actually is, because you don't have a clue.

Yes, I say Gingerich perpetrated a Piltdown-type fraud on the fossils at the U. Michigan.

Again with this. I corrected you both on youtube and in my first post in this forum.

Can you give any evidence for this allegation.
NOT
"this guy other then Gingrich told this"
not
"this drawing that Gingrich did not make"

Actual evidence that:
1. The fossils were actually a fake
2. Gingrich knew it was fake. And if you say: "Gingrich speculated about some aspects about the fossils" That's not lying. Scientists can speculate and Gingrich himself said that he admitted this (admitting speculation is not fraud):
"Terminal caudals [tail vertebrae] are lacking in the type specimen of Rodhocetus and we cannot assess the possible presence of a caudal fluke, but it is reasonable to expect development of a fluke to coincide with shortening of the neck, flexibility of the sacrum and reduction of the hind limbs first observed in Rodhocetus. This idea can be tested when a more complete tail of Rodhocetus is found."- 1994 Nature paper
Notice that he admitted that they didn't had the parts of the the tail, such they couldn't conclusively confirm a tail fluke yet it is still reasonable to expect one given the other evidence they had and he also gave a way to test it when more complete specimens would be found. HOW THE HELL IS THIS FRAUD!?

The skulls were faked to support evolutionism.

What can be presented without evidence, can be dismissed without evidence.
What about the part of the skull Gingrich holds in his hand at 3:32 in this video, what about that is fake?

Also watch it from 3:12 to 6:12.

And contrary to what My esteemed colleague Mr. Neslig wrote, the inner ear bones did NOT resemble pinaped structures.

I feel like asking your for any citation will prove to be futile since I'm to only one who even attempted to demonstrate my points here. Wrong the inner ear bones DID resemble that of Cetaceans.

"Abstract.-A new genus and species of primitive protocetid whale, Pakicetus inachus, is described from the early-middle Eocene Kuldana Formation at Chorlakki, Kohat District, North-West Frontier Province, Pakistan. The holotype is a nearly perfectly preserved posterior portion of a cranium. Pakicetus is distinctive among whales in retaining an extremely primitive auditory region. The auditory bulla articulates with the squamosal, basioc- cipital, and paroccipital in addition to a normal cetacean articulation with the posterior process of the periotic. The cochlear part of the periotic articulates with both the squamosal and the basioccipital. Three genera of early-middle Eocene whales are now known from Pakistan. Pakicetus is intermediate in size between Ichthyolestes and Gandakasia, and it resembles both to some degree in dental morphology. "Protocetus" attocki from Ganda Kas is here referred to Pakicetus."
Read the rest of the article if you dare.

Dr. Werner showed photos of the actual fossils in his textbook and demonstrated that Gingerich and his studen Thewissen misrepresented the fossils and concocted a whale evolution fantasy."

Dr. Werner is a physician, so yeah a real expert on whale and mammal anatomy such as Gingrich is. (sarcasm)
But even that doesn't particularly matter. Dr Werner hasn't reported this mistake to the scientific community by publishing an article correcting Gingrich's fraud. Can you find any peer review article about this that Dr Werner wrote. NO. none.
All you can site is a book written by Werner which isn't a textbook like you claimed it to be.

And I see zero explanation why a fish would evolve to walk on land and become some sort of mammal and then decide to re-evolve and go back into the ocean.

You remind me allot of this guy:

Your ignorance about evolution is not proof against it. Animals don't decide wether to evolve or not. Natural selection just favors changes that are advantageous. That's it. Mammals becoming more adapted to life in water might be advantageous since there is food there even it results in some bad design like being fully aquatic and still having lungs. Or being half way adapted at life in the sea from life on land such that you still depend on land for giving birth or in order to rest, making really awkward creatures.

How can you call this intelligently designed?

And yes we even have the transitional fossils for this too.

There no proof of either schemes as far as I know - the whale evolution cartoon is just propaganda device to get people to believe the fantasy without seeing proof.

The one I mentioned are not cartoons. Neither the video you criticized. They also used pictures of the actual fossils.

On the topic of Berlinski - Mr. Neslig write that he's not a scientist . I say WTF does that mean?
What relevance is the label.

Well, you found it relevant to mention that Berlinski is a scientist, AND I QUOTE:

Finally, on the issue of whales evolving from land animals it should be noted - at least by those who have a critical mind - that one scientist (Berlinski) counted up 50,000 different anatomical and bio-molecular changes necessary for a land mammal to become a whale,

Before, you bragged that Berlinski is a scientist. Now I corrected you that he isn't a scientist, you suddenly find the science label no longer important. Why must I keep calling you out on your Bullshit!

Is a scientist more - or less - credible than a philosopher? Of course not.

When it comes to science, a scientist has more credibility then a philosopher. If you need someone to help you when you have a leakage somewhere in the pipelines of your house.
Would you call a plumber or a philosopher? (rhetorical question).

Even despite the fact that a scientist has more credibility then a philosopher when it comes to science, I said this about Berlinski in my first post.
"And he calls Berlinski a critical mind and a scientist (which he isn't - he is a philosopher). But never mind that,"
Instead of "never mind that" I should be more clear by saying "but this is largely irrelevant, philosophers can be right too".
However, I have demonstrated (multiple times now) that this philosopher is wrong.

Berlinski considered the whale evolution fantasy from a critical approach and claims to have counted 50,000 different anatomical and physiological adaptations that would be necessary for a land creature to become a whale.

Which he didn't do. You know how I know. Because if you where to count 1 change ever 10 seconds it takes you 5 (full 24 hour non stop) days of counting to count 50.000 changes. And in all that time, Berlinski never kept a list of the changes he counted up. And he also forgot to take into account that whales did not evolved from cows in his "critical" approach.You and Berlinski are full of shit.

And what's more. Here is an actual scientist taking a critical approach to Berlinski's claims.

"I’ve tried to do some of these calculations. The calculations are certainly, certainly not hard, but they’re interesting. I stopped at 50,000." - Berlinski.

"Think about that. I want more details of his method. So David Berlinski is sitting. He’s contemplating the cow, and he’s enumerating the changes. Does he just make a hash mark on a sheet of paper when he thinks of one? Does he make a list? He says he came up with 50,000 items, and that it was easy. Let’s see a recitation. Was one of his differences that “cow rhymes with plow, and whale rhymes with tail”? How does he know that any of his litany of changes are actually biologically relevant? And do we really believe that David Berlinski can identify that many significant biological differences between two species of mammals?
I don’t think so. You’d have to be an idiot to believe him.
Which is probably why the DI thought his interview was a worthy contribution."
- PZ Myers

That sound fine to me - the skin, the tail, the teeth, hemoglobin, eyes, ears, you name it. Each of those 50,000 adaptations requires multiple genetic mutations and each mutation must be non-lethal or Beneficial.

Each of those 50.000. What 50.000? You have listed 6 changes (which you have asserted as changes without even giving evidence to back it up).
Not only are you full of shit, you can't even count. 6 doesn't equal 50.000!

And the location of each genetic mutation is random. Selective pressure does not occur until the mutation is expressed, but the occurrence of the mutation is random. Now do the math - roughly. There are perhaps 1 trillion cells in the typical land creature? And only 1 germ cell - so the probability of a germ cell mutation are 1 chance in a trillion. And with each germ cell there are perhaps 1 billion base pairs. So the total chance of a base pair mutation in a germ cell within a land creature is 1 chance in a billion-trillion. And you need that 1 chance to occurs 50,000 times in order to get all the adaptations. So your probability is impossible. Somewhere around 1 chance in 10*100.

Since the 50.000 changes is pure horse shit. This calculation is pure horse shit.

AND it needs to occur in both sexes. AND both sexes of the mutated subject must mate - they must grow up together.
It's impossible.,

Wait, what? Haven't you ever heard about sexual recombination?

If a mutation happens in one male, his daughter (female) can inhered the same mutation, thus mutations don't have to occur in both sexes! They can spread from one sex to another.
Not only don't you have any clue about evolution, you also have no clue about biology in general!

 

[Mr_Wilford]

Re: Educating a creationist about what evolution actually is

Oh, do NOT mention Mr. Werner. Werner is not qualified to speak on this matter. I have spoken EXTENSIVELY with Hans Thewissen myself, and I know for certain that Werner is a certified liar who completely spun what Hans said.

 

[Rumraket]

Re: Educating a creationist about what evolution actually is

I say change the forum title to "Convincing an evolutionist that has been indoctrinated". Or, "Evolution is a fantasy". Here's a possible title "Although they wear lab-coats, evolutionism is not a science".

Yes, I say Gingerich perpetrated a Piltdown-type fraud on the fossils at the U. Michigan. The skulls were faked to support evolutionism.

The quintessential conspiracy-nutter and reality-denialist response is to claim that when the evidence runs against you, then the evidence itself must be fake. This is the ultimate fall-back response you can and will always go to when reality conflicts with your intense religious bias to see a specific conclusion

And contrary to what My esteemed colleague Mr. Neslig wrote, the inner ear bones did NOT resemble pinaped structures. Dr. Werner showed photos of the actual fossils in his textbook and demonstrated that Gingerich and his studen Thewissen misrepresented the fossils and concocted a whale evolution fantasy.

And I see zero explanation why a fish would evolve to walk on land and become some sort of mammal and then decide to re-evolve and go back into the ocean. There no proof of either schemes as far as I know - the whale evolution cartoon is just propaganda device to get people to believe the fantasy without seeing proof.

On the topic of Berlinski - Mr. Neslig write that he's not a scientist . I say WTF does that mean? What relevance is the label. Is a scientist more - or less - credible than a philosopher? Of course not. Berlinski considered the whale evolution fantasy from a critical approach and claims to have counted 50,000 different anatomical and physiological adaptations that would be necessary for a land creature to become a whale. That sound fine to me - the skin, the tail, the teeth, hemoglobin, eyes, ears, you name it. Each of those 50,000 adaptations requires multiple genetic mutations and each mutation must be non-lethal or Beneficial. And the location of each genetic mutation is random. Selective pressure does not occur until the mutation is expressed, but the occurrence of the mutation is random. Now do the math - roughly. There are perhaps 1 trillion cells in the typical land creature? And only 1 germ cell - so the probability of a germ cell mutation are 1 chance in a trillion. And with each germ cell there are perhaps 1 billion base pairs. So the total chance of a base pair mutation in a germ cell within a land creature is 1 chance in a billion-trillion. And you need that 1 chance to occurs 50,000 times in order to get all the adaptations. So your probability is impossible. Somewhere around 1 chance in 10*100.

AND it needs to occur in both sexes. AND both sexes of the mutated subject must mate - they must grow up together.

It's impossible.,

Link

Example 1: Living whales and dolphins found with hindlimbs

"I knew, of course, that some modern whales have a pair of bones embedded in their tissues, each of which strengthens the pelvic wall and acts as an organ anchor. ... Whales could be born with a little extra lump of bone which evolutionists therefore insisted was a throwback corresponding to a second limb bone.

However, the spectacle of a whale being hauled out of the ocean with an actual leg hanging down from its side was a totally different issue. I don't remember my exact response, but I indicated that, if true, this would be a serious challenge to explain on the basis of a creation model." (Wieland 1998)

- Carl Wieland
Young earth creationist,
CEO, Answers in Genesis - Australia,
Joint CEO, Answers in Genesis International,
Editor, Creation magazine

Probably the most well known case of atavism is found in the whales. According to the standard phylogenetic tree, whales are known to be the descendants of terrestrial mammals that had hindlimbs. Thus, we expect the possibility that rare mutant whales might occasionally develop atavistic hindlimbs. In fact, there are many cases where whales have been found with rudimentary atavistic hindlimbs in the wild (see Figure 2.2.1; for reviews see Berzin 1972, pp. 65-67 and Hall 1984, pp. 90-93). Hindlimbs have been found in baleen whales (Sleptsov 1939), humpback whales (Andrews 1921) and in many specimens of sperm whales (Abel 1908; Berzin 1972, p. 66; Nemoto 1963; Ogawa and Kamiya 1957; Zembskii and Berzin 1961). Most of these examples are of whales with femurs, tibia, and fibulae; however, some even include feet with complete digits.

...

Game over.

 

[SpecialFrog]

Re: Educating a creationist about what evolution actually is

AND it needs to occur in both sexes. AND both sexes of the mutated subject must mate - they must grow up together.

This is one of my favourite misunderstandings. We have demonstrated examples of animals with different chromosome counts producing fertile offspring together yet for some reason mutations need to happen to both sexes at once?

 

[DutchLiam84]

Re: Educating a creationist about what evolution actually is

AND it needs to occur in both sexes. AND both sexes of the mutated subject must mate - they must grow up together.

This claim, especially, is telling me that yet again, the creationist has no idea how evolution works. This is a Ray Comfort level of thinking. Unless the creationist wants to learn what evolution is and how it works, correcting him/her on any mistakes is futile.

EDIT: I see I'm not the only one thinking this.

 

[leroy]

Re: Educating a creationist about what evolution actually is

Inferno is just playing semantics; the fact is that bats and dolphins have genetic similarities that were not expected. And that can´t be explained with common ancestry.

Someone whose arguments are roughly 90% semantics should probably not accuse others of playing semantics. Also, did you read that thread or did you just remember it from when you used to be dandan?

Besides, the argument quoted is hardly semantic. Do you recognize that there is a difference between different DNA strands producing similar proteins and similar DNA strands?

This is a list of uncontroversial assertions.

The article is referring to hundreds of proteins that are present in all mammals.

Each mammal has a “unic” version of these proteins

The difference between the “dolphin proteins” and “bat proteins” is smaller than the difference between “Dolphin proteins” and “whale proteins”

These was not expected by the common ancestry model, it doesn´t fit the nested hierarchy pattern
----------------------------------------------------------------------------------------------------------------------------------------------------
There are all uncontroversial statement, at worst you could say that I am oversimplifying things.
The only controversial point is weather if this discordance is statistically significant or not, but don´t worry Rumraket would provide us with a statistical equation and we would test if this discordance is significant or not.

 

[leroy]

Re: Educating a creationist about what evolution actually is

Granted, I understand the difference,

The article talks about 200 substitutions, is 200 big enough to be considered statistically significant? In other words is it possible for 2 independent linages to suffer from the exact same mutations 200 times?

The article that you posted has absolutely nothing to do with this issue, your articles “proves” that trees based on anatomical similarities and trees based on biochemistry are similar. That is an interesting topic, but it has nothing to do with this particular issue.

So please provide your statistical model, in the moment when you admit that such statistical model doesn’t exist, I would provide My own model and prove that it is statistically impossible for 2 independent lineages to suffer from the same mutations 200 times.

 

[leroy]

Re: Educating a creationist about what evolution actually is

The problem is that true chimeras have been found.

For example Echolocation is bats and dolphins.

Bats and dolphins both devolved a complex system of echolocation. You can´t explain this with common ancestry because bats and dolphins are not close relatives and their common ancestors was a mammal without a system of echolocation.
This means that dolphins and bats developed this ability independently.

Yes, it's called convergent evolution. Where two different lineages independently evolve features that have the same function.
I guess, I should have informed you about it earlier. I don't know why you didn't use this as an example of convergence.

All three animals (one extinct of course) use essentially the same bones in the structure of their wings: Humerus, ulna, radius, etc.
And I expect, because they use the same bones, similar genes would be involved in building their wings. However, there are notable differences.
Birds use three finger bones (now fused together) and their wings use feathers.
Bats use four finger bones as the frame of the wing which uses a membrane, with the "thumb" sticking out the wing.
Pterosaurs used a ridiculously elongated pinky finger to support their wing membrane, but the membrane, though similar looking, was very unlike the membranes of bats. The really advanced pterosaur had membranes full of various fibers including muscle, such that they had an incredible flight control. Some even had resperatory air sacs extending from cavities inside their bones into the wing membranes.
Even though they use the same bones, which they inherited from their common ancestor, for their wings, they modified those bones into wings by different means, which doesn't matter, as long as it works.
In order to fly, it requires several things like being light weight and have wings: thin airfoil-, streamlined structures with a large surface area that can produce the necessary lift. Which is what all these three examples did develop, but again by different means.
Similar (analogous) things can evolve independently, but not identical things
Thus this doesn't violate phylogeny. As with the echolocation of bats and dolphins, which I will explain next.

Ecolocation in bats and dolphins is almost identical even at a molecular level (same proteins same genes)
Finding two unrelated animals with echolocation is as bad as finding a horse with feathers.

Not quite as bad, which I will explain in a moment. But first addressing your claims:
1 "Ecolocation in bats and dolphins is almost identical"
2 "even at a molecular level (same proteins same genes)"

#1 Let's look at how the echolocation of bats and dolphins work.
In order to echo locate you need two basic things. One, the ability to generate and emit sound waves and two receive the echo it produces. Again, how you manage to do this, doesn't matter.
Bats generate ultrasound with their larynx and emit it through their open mouth or in some cases their nostrils.

Dolphins on the other hand produce their sound by passing air from the bony nares through the phonic lips. The sound is reflected by the animals thick concave bone of the cranium and the sound is modulated by the fatty organ called the 'melon' almost like an acoustic lens, focussing the sound waves in one direction.

Very different mechanisms for generating and emitting sound. Although receiving the echo is the same. They use their ears, which they did inherited from a common ancestor.
Starting to see a pattern here?

Note that the only thing you need to echolocate is emitting sound and receiving echo. You might ask, we can do both so why can't we echolocate. Well surprisingly we can, people who are blind often learn to echo locate and in some extreme cases blind from birth just develop the skill naturally, but we suck at it compared to those that can emit much more sound and have very sensitive hearing.


The key is sensitive hearing and all mammals have this trait because they have an inner ear structure with unique auditory ossicles that can pick up sounds almost no other group of tetrapods can, which evolved in the ancestors of mammals.

Once again, common ancestry, which is why almost all echolocating animals are mammals and the ones that are really good at it are all mammals. But it is still amazing that humans can echolocate like the superhero daredevil (the real batman). People like the one in the video actually report a description of their echo sense as visual patterns. And brain activity of these people support that they process auditory information to produce a visual image, a form of synesthesia that makes sound translated into sight and we all have the potential to do that.

Too bad our feet aren't sensitive enough for echolocation, because that would've been awesome.

#2: Almost identical at the molecular level (same proteins same genes).
I looked that the citation you provided, but nowhere does it say that the genes where identical, nor in the original article.

The only similar statement that it said was:
"in 2010, Stephen Rossiter, an evolutionary biologist at Queen Mary, University of London, and his colleagues determined that both types of echolocating bats, as well as dolphins, had the same mutations in a particular protein called prestin, which affects the sensitivity of hearing. Looking at other genes known to be involved in hearing, they and other researchers found several others whose proteins were similarly changed in these mammals."

Notice that it doesn't say that the proteins and genes are identical. The mutations where identical and they happen in the same genes. Prestin in particular which is involved in hearing, not surprising since both bats and dolphins use hearing in echolocation.

But the genes as a whole are not identical. Let me demonstrate.
I took the nucleotide sequences of the prestin genes of both echolocating bats and echolocating dolphins and compare it with the sequences of their relatives that don't echolocate. You can do this too using NCBI blast.

Let's do this science style.

Question: What are the relationships between the gene sequences of the gene prestin of echolocating animals (certain bats and dolphins) and their close relatives.

Hypothesis 1 (common ancestry): Even though prestin of dolphins and certain bats contain similar changes as an adaptation towards echolocation, the relationship between them and their relatives should still follow the model of common ancestry. The prestin of echolocating bats should be more similar to that of non-echolocating bats and that of dolphins should be more similar relatives like other Cetaceans that don't echolocate.

Hypothesis 2 (Identical at the molecular level, same proteins same genes): Since prestin is identical in both echolocating bats and dolphins, they should be more similar to each other, even more then sequences of those that are supposedly more closely related to them than either one are to each other.

Data:
Prestin cDNA sequences of:
1. Echolocating animals
- Bottlenose Dolphin
- Little brown bat

2. Non echolocating animals
Close relative of dolphins:
- Mink whale
Close relative of echolocating bats:
- Large Flying Fox

Methods: NCBI blast

Results:
1 Close relative comparisons (echo locators on their non echo locator relative).
- Bottlenose Dolphin / Mink whale = 97% match
- Little brown bat / Large flying fox = 93% match

2. Echolocators comparisons
- Little brown bat / Bottle Nose dolphin = 92% match

Conclusion:
There is a closer match between the echo locators and their close relatives then there is between the echo locators themselves, which was expected by the hypothesis based on common ancestry.

So you challenge is:
¿how do you explain echolocation in bats and dolphins? And whatever explanation that you provide, ¿what can´t that explanation could be used to explain feathers in horses?
¿what is fundamentally different between horses with feathers and bats with “dolphin-like echolocation”?

The difference is that horses with feathers have actual feathers, identical to those of the feathers of birds.
Bats don't have dolphin echo location, which is why you said "dolphin-like" instead.

And note that echo location requires only the ability to make sound waves and sensitive hearing to detect the echo, which even humans who usually don't echolocate still have and with training can even develop a weak form of echolocation. Feathers on the other hand require allot more then that. Feathers you see on flying birds are a highly complex structure that evolved through several sequential stages of development over a span of over a hundred and fifty million years.

Now, different types of animals have independently evolved different types of eyes which are unique to that lineage (again, concordant with common ancestry), like vertebrates have their unique type of eye with the blind spot and all Cephalopods have their unique eye structure.

You will never find a Vertebrate with a Cephalopod eye or vise versa. Isn't that odd?

And you also can have similar mutations occurring within similar genes that have similar effects independently in different lineages, however (in the case of feathers) such a precise alignment of this sequence with these particular developments over such a long period of time, could not have evolved twice. Fully developed flight feathers are a one time occurrence. They have first appeared in theropod dinosaurs and were inherited by birds and are exclusive to this group.

Thanks for your post, but at the end of the day, if you what to argue that convergent evolution took place, you would have to argue that 2 independent clades suffer from the same mutations 200 independent times.

So my questions is ¿why can´t horses suffer from 200 mutations related to the development of birdlike feathers? Why can´t horses follow the same path that birds did and develop feathers? If bats and dolphins did it, why not horses?

Obviously I am not suggesting that horses can “evolve” feathers, it would be extremely unlikely for horses to suffer from the exact same mutations that birds did. But that is my point, it is also extremely unlikely for bats to have suffered from the same mutations than dolphins

 

[DutchLiam84]

Re: Educating a creationist about what evolution actually is

Unlikely ≠ impossible!

 

[SpecialFrog]

Re: Educating a creationist about what evolution actually is

the fact is that bats and dolphins have genetic similarities that were not expected. And that can´t be explained with common ancestry.

Do you recognize that there is a difference between different DNA strands producing similar proteins and similar DNA strands?

The difference between the “dolphin proteins” and “bat proteins” is smaller than the difference between “Dolphin proteins” and “whale proteins”

These was not expected by the common ancestry model, it doesn´t fit the nested hierarchy pattern

There are all uncontroversial statement, at worst you could say that I am oversimplifying things.

No, I can also say that you are equivocating by trying to pretend that similarities in proteins means genetic similarities (which is what you claimed above). Moreover, you are trying to pretend that common ancestry inherently predicts a certain hierarchy of proteins produced by organisms.

It has been pointed out to you repeatedly that if you look at the genes that produce the proteins you are talking about you do not see the discordance above. The wording of your argument suggests you accept this (though you seem reluctant to admit it).

Genes are passed on to descendants. Proteins are not. Because genes determine proteins you should expect that usually genetic similarity will cause protein similarity, but because different genes can produce the same proteins you should also expect collisions.

There is no conflict here with the common ancestry model.

 

[Nesslig20]

Re: Educating a creationist about what evolution actually is

Thanks for your post, but at the end of the day, if you what to argue that convergent evolution took place, you would have to argue that 2 independent clades suffer from the same mutations 200 independent times.

uhh, didn't I just explained/refuted that that in my last reply?

Ecolocation in bats and dolphins is almost identical even at a molecular level (same proteins same genes)

I looked that the citation you provided, but nowhere does it say that the genes where identical, nor in the original article.

The only similar statement that it said was:
"in 2010, Stephen Rossiter, an evolutionary biologist at Queen Mary, University of London, and his colleagues determined that both types of echolocating bats, as well as dolphins, had the same mutations in a particular protein called prestin, which affects the sensitivity of hearing. Looking at other genes known to be involved in hearing, they and other researchers found several others whose proteins were similarly changed in these mammals."

Notice that it doesn't say that the proteins and genes are identical. The mutations where identical and they happen in the same genes. Prestin in particular which is involved in hearing, not surprising since both bats and dolphins use hearing in echolocation.

But the genes as a whole are not identical. Let me demonstrate.
I took the nucleotide sequences of the prestin genes of both echolocating bats and echolocating dolphins and compare it with the sequences of their relatives that don't echolocate. You can do this too using NCBI blast.

Let's do this science style.

Question: What are the relationships between the gene sequences of the gene prestin of echolocating animals (certain bats and dolphins) and their close relatives.

Hypothesis 1 (common ancestry): Even though prestin of dolphins and certain bats contain similar changes as an adaptation towards echolocation, the relationship between them and their relatives should still follow the model of common ancestry. The prestin of echolocating bats should be more similar to that of non-echolocating bats and that of dolphins should be more similar relatives like other Cetaceans that don't echolocate.

Hypothesis 2 (Identical at the molecular level, same proteins same genes): Since prestin is identical in both echolocating bats and dolphins, they should be more similar to each other, even more then sequences of those that are supposedly more closely related to them than either one are to each other.

Data:
Prestin cDNA sequences of:
1. Echolocating animals
- Bottlenose Dolphin
- Little brown bat

2. Non echolocating animals
Close relative of dolphins:
- Mink whale
Close relative of echolocating bats:
- Large Flying Fox

Methods: NCBI blast

Results:
1 Close relative comparisons (echo locators on their non echo locator relative).
- Bottlenose Dolphin / Mink whale = 97% match
- Little brown bat / Large flying fox = 93% match

2. Echolocators comparisons
- Little brown bat / Bottle Nose dolphin = 92% match

Conclusion:
There is a closer match between the echo locators and their close relatives then there is between the echo locators themselves, which was expected by the hypothesis based on common ancestry.

Despite your claim, gene sequences of bats are still more similar to non echolocating bats rather then to echo locating dolphins. But if they had 200 identical mutations, why are these genes not more similar then there close relatives? Well reason one because of common ancestry.
And two: As someone else tried to explain to you, different mutations can have the same results. But first, a quick education in genetics.
Genes code for protein, but you must know how. Without to many details, genes have codons, which are 3 nucleotides like A-T-G. Each codon codes for one amino acids. ATG in particular codes for methionine or Met for short.
There are 20 amino acids and there are (4x4x4) 62 possible codons. This results in severe redundancy, where two or more codons code for the same amino acid.
For example, codons:
CGT
CGC
CGA
CGG
AGA
AGG
All code for Arginine or Arg.

These two very different DNA sequences still produce the same protein:
1. ATGCGTCGACGGCGCCGTCGACGGCGCTAA
2. ATGAGAAGGAGAAGGAGAAGGAGAAGGTAA

Protein: Met-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg

Now we come back to the question, how can different mutation result in the same effect? Well let's take one example.
If you start with this codon:
TGG
(which codes for Tryptophan)
and mutate it into codon
AGG
by replacing the T with A you get a codon that codes for Arginine.
You can also do it in another way.
TGG
replacing T with C
CGG
Also encodes for Arginine. Thus you have now two different mutation that results in the same thing.
You can also start with different codons each having different mutations that make different codons, but will still result in the same thing.

TGT (= Cysteine) [replace T with C] CGT (=Arginine)

ACA (=Threonine) [replace C with A] AGA (=Arginine)

In fact, if you do the calculations, the number of possibilities of changing any that don't code for Arginine into any codon that does (by just one substitution mutation replacing one nucleotide by another) = 36

There are 36 possibilities that will change one codon which doesn't code for Arginine into one that does. And this is just by one substitution mutation. If you would calculate the possibilities with multiple mutations allowed, the possibilities would just increase even further.
Chances are that those "same 200 mutations" were not the same. They could be very different mutations that resulted in the same effect, changing different codons into also different codons that code for the same amino acid.

And that's why the sequences of the prestin genes of echo locating bats are still more similar to other bats then to echo locating dolphins.

So my questions is ¿why can´t horses suffer from 200 mutations related to the development of birdlike feathers? Why can´t horses follow the same path that birds did and develop feathers? If bats and dolphins did it, why not horses?

Didn't I just explained that too?

So you challenge is:
¿how do you explain echolocation in bats and dolphins? And whatever explanation that you provide, ¿what can´t that explanation could be used to explain feathers in horses?
¿what is fundamentally different between horses with feathers and bats with “dolphin-like echolocation”?

The difference is that horses with feathers have actual feathers, identical to those of the feathers of birds.
Bats don't have dolphin echo location, which is why you said "dolphin-like" instead.

And note that echo location requires only the ability to make sound waves and sensitive hearing to detect the echo, which even humans who usually don't echolocate still have and with training can even develop a weak form of echolocation. Feathers on the other hand require allot more then that. Feathers you see on flying birds are a highly complex structure that evolved through several sequential stages of development over a span of over a hundred and fifty million years.

Now, different types of animals have independently evolved different types of eyes which are unique to that lineage (again, concordant with common ancestry), like vertebrates have their unique type of eye with the blind spot and all Cephalopods have their unique eye structure.

You will never find a Vertebrate with a Cephalopod eye or vise versa. Isn't that odd?

And you also can have similar mutations occurring within similar genes that have similar effects independently in different lineages, however (in the case of feathers) such a precise alignment of this sequence with these particular developments over such a long period of time, could not have evolved twice. Fully developed flight feathers are a one time occurrence. They have first appeared in theropod dinosaurs and were inherited by birds and are exclusive to this group.

I've also noticed a theme here. These are some of your statements that I've corrected.

1. Statement: "The fact that we share some percentage of DNA with chimps doesn’t prove that we are related"
Correction: Genetic similarity does prove relatedness, we use it in paternity tests.

2. Statement: "First of all, paternity test can only tell you if someone is your father or mother, and with a low degree of certainty."
Correction: Paternity tests can be 99.99% reliable and if you have a son, father and grandfather. You can use two paternity tests (one on son and father and another one on father and grandfather) to demonstrate son and grandfather relationship with 99,98% reliability.

3. Statement: "no judge would ever accept a paternity test for a great grandfather."
Correction: Judges Do accept the validity of paternity tests.

4. Statement: "Paternity test are based on the assumption that our genes are a combination of mom and dad"
Correction: The fact that we inherit DNA from our parents is NOT an assumption you idiot!

5. Statement: "the science of paternity tests and the science that is supposed to prove universal common ancestry are not the same"
Correction: They are since both rely on Genetics and use DNA comparison of genetic homology. The only difference is scale, as in the difference between inches and miles.

6. Statement: "Ecolocation in bats and dolphins is almost identical"
Correction: Echolocation involves generating and emitting sound waves and receiving the echo. Bats generate sound with their larynx and emit sound via their open mouth or nostrils. Dolphins generate sound by passing air from the bony nares through the phonic lips and emit it by reflecting the sound waves by the thick concave bone of the cranium and the sound is modulated by the fatty organ called the 'melon'. Very different mechanisms of echo location. The only identical thing about their method of echolocation is they use hearing to receive the echo, and guess what, both bats and dolphins inherited hearing from their common ancestor.

7. Statement: "identical even at a molecular level"
Correction: One gene in particular, called prestin, that is involved in echolocation of certain bats and dolphins, which your own citation gave, are more similar in their close, non echo locating, relatives than between them. Not identical.

Do you honestly admit your errors and accept the correction?

 

[Rumraket]

Re: Educating a creationist about what evolution actually is

[There is no semantics at play here. Statistically speaking there is an enormous difference between having the same amino-acid substitutions in key locations in some of your proteins, versus having the exact same nucleotide sequence in your protein-coding genes..

Granted, I understand the difference,

The article talks about 200 substitutions, is 200 big enough to be considered statistically significant? In other words is it possible for 2 independent linages to suffer from the exact same mutations 200 times?

Yes it is possible. And the longer the time between them the more likely it becomes (because, statistically speaking after enough time has passed all possible mutations have happened).

But bats and dolphins aren't of course THAT distantly related, so in this case the question becomes if 200 mutations showing bats and dolphins as more closely related, than the rest of their genes, is enough to represent a statistically significant incongruence.

The article that you posted has absolutely nothing to do with this issue, your articles “proves” that trees based on anatomical similarities and trees based on biochemistry are similar.

It is not ONLY about anatomical and genetic similarities. You can also construct a phylogeny from multiple independent genes. In such a case you can do a phylogeny using cytochrome c and then any one of those supposed 200 similar genes.
Or you can even do a study on all the shared genes and determine the statistical significance of those 200 similar genes compared to the rest of the shared genes.

So it has everything to do with the issue, because two different species indpendently suffering the same mutations would produce a phylogeny that was incongruent with one constructed from, for example, a core metabolic gene like cyt-C, if you tried to do a phylogenetic relationship using the genes containing those similar mutations. In such a case the statistical significance of the incongruence can be weighed using the methods explained.

It is, in point of fact, what you are asking for.

In this link (which was in the article): http://www.talkorigins.org/faqs/comdesc/incongruent.html
Another example is given where you could, for example, do a phylogeny using mitochondrial genes and compare it to a phylogeny done using something else, which could be one of those echolocation-related genes. That would be yet another way to do it and measure the statistical significance of the incongruence between these independent phylogenies.

So please provide your statistical model, in the moment when you admit that such statistical model doesn’t exist,

It has been provided now three times at least. So it manifestly exists. Stop saying it doesn't exist. If there's something about this you don't understand, ask instead of pretending.

 

[he_who_is_nobody]

Re: Educating a creationist about what evolution actually is

Thanks for your post, but at the end of the day, if you what to argue that convergent evolution took place, you would have to argue that 2 independent clades suffer from the same mutations 200 independent times.

uhh, didn't I just explained/refuted that that in my last reply?

...

So my questions is ¿why can´t horses suffer from 200 mutations related to the development of birdlike feathers? Why can´t horses follow the same path that birds did and develop feathers? If bats and dolphins did it, why not horses?

Didn't I just explained that too?

Oh, that is leroy's [sarcasm]greatest strength[/sarcasm]. He is the master of asking questions that have already been answered. His second [sarcasm]greatest strength[/sarcasm] is to reply in rapid action to several people. If you look back at his last two posts, he took almost twenty minutes to reply to your post (which might be the longest ever). Both of those [sarcasm]strengths[/sarcasm] might be related

I've also noticed a theme here. These are some of your statements that I've corrected.

...

Do you honestly admit your errors and accept the correction?

Good luck getting leroy to admit any of these. You would have better luck pulling teeth from a crocodile and living.