Common ancestry of apes

[AronRa]

There is a video where a pastor is defending Roy Moore. So I commented, "A pastor saying "You can't say it like it's fact". How ironic. All religion does is assert empty unsupported speculation as if it were fact." My comment got the attention of a creationist commenter.

AronRa, anyone who is honest and has heard you talk about your belief system. knows you do the exact same thing.

No, the things I say are verifiably accurate.

As I recall, you believe in a mythological common ancestor of man and chimp.

Creationists often use the logical fallacy of false equivalence, asserting that faith is based on evidence just like science is and science relies on faith just like religion does. So "you're just as bad as me and I'm just as good as you." Owen's version of this is to assert that my science is merely mythology just like his religion is. This is also the tu quoquee fallacy, because he asserts that science is a belief-system. Believers must know how dishonest their position is because they keep trying to project their faults onto those who will not share them.

Just for clarification, a belief-system has required beliefs and prohibited beliefs, but free thought is exactly opposite of that. It doesn't matter what you believe, all that matters is why you believe it.

So the very first thing Owens said was false. His second sentence was false too.

my·thol·o·gy
/məˈTHäləjē/
noun
1. a collection of myths, especially one belonging to a particular religious or cultural tradition.
"Ganesa was the god of wisdom and success in Hindu mythology"
synonyms: myth(s), legend(s), folklore, folk tales, folk stories, lore, tradition
"no ancient culture is without its mythology"
2. the study of myths.

myth
/miTH/
noun
1. a traditional story, especially one concerning the early history of a people or explaining some natural or social phenomenon, and typically involving supernatural beings or events.
synonyms: folk tale, folk story, legend, tale, story, fable, saga, mythos, lore, folklore, mythology
"ancient Greek myths"
2. a widely held but false belief or idea.
"he wants to dispel the myth that sea kayaking is too risky or too strenuous"

Science is neither a tradition nor a story. It's an investigation, which means it changes according to indications of evidence, where his mythology can't. Science doesn't involve the supernatural either because it has to be testable and potentially falsifiable. As I told this guy before, whatever I say has to be verifiably accurate or it's wrong, but whatever believers say is at best unsupported assertions. So they're accidentally false when they're not deliberately false. What my critic has done is put himself on equal standing with me. If I have to produce scientific evidence of my position, then he has to do the same for his own.

Creationists also commonly argue that "we both have the same evidence", which of course isn't true either. Evidence is a body of objectively verifiable facts which are positively indicative of, or exclusively concordant with one available conclusion over any other. If the same fact is still true in either scenario then it isn't evidence. It doesn't become evidence until it aligns with only one of the options over the others. I will show Owens the evidence of my position and he will not be able to contest any of it, nor will he be able to produce any evidence in favor of his own position.

So we don't have the same evidence, but we do have the same observation to explain. In this case, that observation is biodiversity. Why is the tree of life structured as it is? Why do we have all these different breeds of dogs and pigeons, cats and cattle and so on? Why are there taxonomic hierarchies beyond that between different parent groupings of lizards, as there are for birds and everything else? If Owens were sincere in his position, he would take the Phylogeny Challenge. But as he is a creationist, he will not take that challenge because he is not sincere. He only wants to make-believe.

So I'll have to explain to Owens how evolution offers the only explanation for all these and many other things, while he will be unable to show how his mythology can explain any of it.

You have no scientific name for this mythological creature.

He is not talking about the morphological "missing link" that was predicted by Darwin and discovered in 1974 (and many more times since then). He's talking about the common ancestor of that and of chimpanzees. He's talking about Dryopithecus fontana.

You cannot even give a scientific description of this mythological creature.

Owens actually provided a scientific description for me with his immediate citation of an article in Scientific American, "Fossil Reveals What Last Common Ancestor of Humans and Apes Looked Liked". It was so nice of him to provide the evidence proving that I'm right and he's wrong before we even begin.

How is that not unsupported speculation?

Because all the evidence, including the bit you just cited supports it. That article confessed that they didn't have enough of the skull to build a facial restoration. So we can't yet say what it looked like, (other than it looked vaguely like a gibbon) but that doesn't mean it didn't exist, or that the fragments of it don't match subsequent Hominids.

what is your evidence that Dryopithecus fontana is the common ancetor of both humans and apes?

So once we had the evidence confirming that we are evolved apes, we then needed evidence of intermediate connections between us and them. We now have a couple dozen species representing different stages of that transition, and none of them would exist under the creationist model.

Then once we knew our origin among the apes, we needed evidence of the origin of the other modern apes too. Once we established the Dryopithecines are basal to both modern apes and humans, the problem was that they're European. So we needed evidence of Dryopithecines in east Africa, and now we have it. Dryopithecus fontana.

What more evidence could we possibly need that we don't already have?

We don't have evidence confirming that we are evolved apes.

Don't we? We know that evolution happens, that significant beneficial mutations do occur and are inherited by descendant groups, and that multiple independent sets of biological markers exist to trace these lineages backward over many generations. We know that the collective genome of all animals has been traced to its most basal form, and that those forms are also indicated by comparative morphology, physiology, and embryological development. Consequently we know that everything on earth has definite relatives either living nearby or evident in the fossil record, and we know that the fossil record holds hundreds of transitional species even according to its strictest definition. We also know that both microevolution and macroevolution have been directly observed, and that evolutionary variation is pervasive and ubiquitous throughout the biology. That's why evolution is the basis of modern biology.

We also know that humans are a subset of apes, primates, eutherian mammals, and vertebrate deuterostome animals.This fact was observed by many naturalists and philosophers long before Darwin, but most notably by Carolus Linneaus who devised taxonomy, the systematic classification of life.

"Why I demand of you, and of the whole world, that you show me a generic character -one that is according to the generally accepted principles of classification- by which to distinguish between Man and Ape. I myself most assuredly know of none. I wish somebody would indicate one to me. But, if I had called man an ape, or vice versa, I would have fallen under the ban of all ecclesiastics. It may be that as a naturalist, I ought to have done so."

282 years later and still no one can answer that question, because in fact humans ARE apes: meaning that we are part of the superfamily, Hominoidea.

Nor do we have evidence of intermediate connections. What we do have are either extinct apes or extinct humans based on a few questionable bone fragments. There is no consensus on any of the so-called intermediate stages.

Wrong. Here is a really old list that needs updating.

Ardipithecus ramidus kadabba (5.8-5.2 mya) (5 sites, 5 individuals, 0 crania)
Ardipithecus ramidus ramidus (4.4 mya) (2 sites, >50 individuals, 0 crania)
Australopithecus afarensis (4.2-2.96 mya) (11 sites, ~120 individuals,>8 crania)
Australopithecus africanus (2.9-2.4 mya) (7 sites, ~130 individuals, 25 crania)
Australopithecus anamensis (4.17-3.9 mya) (2 sites, 10 individuals, 0 crania)
Australopithecus bahrelghazali (3.5-3.0 mya) (1 site, 1 individual, 0 crania)
Australopithecus garhi (2.5 mya, 3 sites, 4 individuals, 1 cranium)
Homo antecessor (800 kya, 1 site, >5 individuals, 0? crania)
Homo erectus/ergaster (1.9-0.4 mya, >34 sites, >210 individuals, >62 crania)
Homo habilis (2.3-1.6 mya, 7 sites, 25 individuals, 11 crania)
Homo heidelbergensis (700-100 kya, 26 sites, 60 individuals, 20 crania)
Homo sapiens neanderthalensis (250-25 kya, >31 sites, >77 individuals,>27 crania
Homo sapiens sapiens, >10 kya only (130 kya to recent, >75 sites, >154 individuals, numerous crania)
Homo rudolfensis (1.9 mya, 2 sites, 5 individuals, 3 crania)
Kenyanthropus platyops (3.3 mya, 1 site, 3 individuals, 1 crania)
Orrorin tugenensis (6.3-5.6 mya) (4 sites, 5 individuals, 0 crania)
Paranthropus aethiopicus (2.7-1.9 mya, 2 sites, 8 individuals, 2 crania)
Paranthropus boisei (2.5-1.4 mya, 9 sites, 43 individuals, 13 crania)
Paranthropus robustus (2.0-1.5 mya, 3 sites, 28 individuals, 20 crania)
Sahelanthropus tchadensis (7.0-6.0 mya) (1 site, 6 individuals, 1 cranium)

based on this limited data, we have nearly 1,000 individuals, with nearly 200 crania. I expect the final number to be over 3,000 given the estimate of the Catalogue ofFossilHominid published by the British Natural History Museum (almost 4000 as of 1976). It is unclear if this refers to NISP or MNI.

The consensus is that all of these are both extinct apes and extinct hominines. Most of these were predicted by evolutionary theory and should ONLY exist if evolution is true. None of these would exist if creationism were true. How would you--as a creationist--explain extinct humans?

No evidence exists for the evolution of modern apes.

You know, when you haven't studied a particular subject any at all and consequently have absolutely no idea what you're talking about, you probably shouldn't pretend that you know more than all the world's best educated expert specialists in that field. Because we have extensive evidence for the evolution of apes with way more of those species represented in the fossil record than still exist today.

Anyone can line up fossils fragments, and make the specious claim that one evolved into the other. Pure science fiction.

You misspelled--and misrepresented--scientific fact. Science is entirely different than a belief system or mythology in that it is an attempt to improve understanding. The only way to do that is to seek out the flaws in your current perspective and correct them. Science does this with predictive hypotheses. If our current understanding of evolution is true then we should find fossils older than modern humans with traits intermediate between us and other apes. That hypothesis was vindicated again and again and again with the above list of dozens of fossil species.

Of course creationists predicted that none of these things would be discovered. Then when they were, creationists had to start lying, saying that Lucy was "just a chimpanzee" or that Neanderthal man was "just an old modern man with rickets". It doesn't matter that every paleoanthropologist knows that Australopithecines were not chimpanzees, nor that we've found hundreds of individual neanderthals including women and children too. When you have a belief system, you have to deny the facts to keep convincing yourself of what you already know can't really be true. That's what religion does, and that's why science is the very opposite.

Evolutionists do this all the time. They claim something evolved into something else and then get busted when it turns out that one of their so-called intermediates is still alive and well !

Do you have an example of that? I bet not because that's never happened, but there's no requirement that when a new species evolves that every member of the parent species had to have died out.

We have not established that Dryopithecines are basal to booth moderan apes and humans.

The article you cited explains otherwise. How could you have quoted one paragraph ouf of that without reading the rest of it?

Dryopithecus is a very broad genus including at least forty species as diverse as gibbon-sized to gorilla-sized, but not actually gibbons or gorillas. Dryopithecines are hominids [family Hominidae] that came before Homininae. The oldest fossils are in Eurasia, and the genus, Pongo [orangutans et al] is Asian, indicating that although Dryopithecus fontana was found in eastern Africa, where the genus Homininae evidently evolved, their ancestors and the crown of Hominidae actually came from Asia through Eurasia.

You have ZERO evidence to support that claim.

Taxonomy was replaced with cladistic phylogenetics. It's a twin-nested hierarchy where the trees constructed on morphology can be confirmed genetically. It's rather like taking a paternity test to confirm who your daddy is. Same principle.

This image is taken from the Public Library of Science article, A Molecular Phylogeny of Living Primates.

"Here we provide new genomic sequence (∼8 Mb) from 186 primates representing 61 (∼90%) of the described genera, and we include outgroup species from Dermoptera, Scandentia, and Lagomorpha. The resultant phylogeny is exceptionally robust and illuminates events in primate evolution from ancient to recent, clarifying numerous taxonomic controversies and providing new data on human evolution. Ongoing speciation, reticulate evolution, ancient relic lineages, unequal rates of evolution, and disparate distributions of insertions/deletions among the reconstructed primate lineages are uncovered. Our resolution of the primate phylogeny provides an essential evolutionary framework with far-reaching applications including: human selection and adaptation, global emergence of zoonotic diseases, mammalian comparative genomics, primate taxonomy, and conservation of endangered species."

Scientific evidence can't really get any more conclusive than that. So much for your "ZERO evidence" accusation.

You understand that this is a fact, (or a rather a series of them) that was predicted by evolutionary theory because it only aligns with evolution and clearly contradicts creationism, right? Because creationists predicted this would not turn out to be the case. They were wrong again as always. Every prediction falsified.

If evolution is true, what observation, discovery, or experiment could reveal that?
If evolution is not true, then what observation, discovery, or experiment do you predict would reveal that?
If creationism is not true, what observation, discovery, or experiment do you predict could show that?
If creationism is true, what observation, discovery, or experiment could reveal that?

That's your belief. But until you provide evidence, it's just an empty assertion.

So here we are. You were wrong on every assumption/assertion/allegation. Every single sentence you said was wrong on every point therein. Yet you think you once refuted me and that you can do it again? You obviously didn't disprove me then just like you can't now either.

 

[Sparhafoc]

The problem is, as is typical, the Creationist wants desperately to appeal to the legitimacy of science while simultaneously exhibiting a profound incomprehension about the nature of science and how it works.

When a religionist stakes their claim that god made the world or whatever, but bases that solely on faith - I think it's silly, but it's still ultimately their opinion; their mental real-estate, and as such, it's their business what they believe. But when a religionist needs to revise history, lie about science, and pervert truth and honesty then it becomes a different game altogether as they are contributing to the ever-swelling ignorance of our species at a time when our species has never been so dependent on reason, knowledge, and technology. In the Information Age, disinformation is criminal.

You cannot even give a scientific description of this mythological creature.

Whereas in reality, evolutionary theory allows us to make very detailed predictions about the description of hypothetical organisms which would represent an intermediary between two points of the historical gradient of evolutionary change of any given taxon.

Predictions, of course, being absolutely essential to either the value or validity of a hypotheses.

We don't have evidence confirming that we are evolved apes.

Aside from all the evidence 'confirming' it, the chap doesn't understand that science doesn't make absolute declarations, rather, it attempts to falsify positions which otherwise seem justified by observation and cautious hypothesis formation.

As such, the fact that there is no evidence falsifying the hypothesis is far more relevant in terms of our confidence in this notion. Regardless of how much evidence there is (and there's a lot) corroborating the idea that humans are apes and that all present day apes evolved from a common ancestor, if we found just one piece of evidence contradicting this then the idea would be wrong, or at least our naive capitulation of the idea. This is the entire point of the competitive element in science.

Nor do we have evidence of intermediate connections. What we do have are either extinct apes or extinct humans based on a few questionable bone fragments. There is no consensus on any of the so-called intermediate stages.

We don't have evidence.... aside from all the fossils and bone fragments I will now attempt to discredit.

Such sentences as the above smack more of mendacity than ignorance, but regardless, it is still indicative of scientific illiteracy.

Science is consensus. That doesn't mean it happens in some naive scientifically illiterate way, rather utility is the currency of scientific consensus. Consensus doesn't operate by getting all the relevant scientists in a discipline to a sit-down discussion where they have at it, instead, scientists all over the world publish their findings and ideas in journals. Other scientists read those journals and may thereby discover the solution to a problem that long blocked their own research, or they might dispute a publicized idea and seek to test it and falsify it, or they might see the proposed ideas as being either useful or without utility in their field.... any which way, the original paper gets cited, gets explored, gets critiqued, gets tested... and if it continuously survives falsification, and if it continually provides utility to other scientists in the field, then it becomes a consensus.

While from a philosophical point of view, the plurality of inter-subjective actors are essential to any potentially valid theory of truth, there's an even more prosaic explanation for a consensus, and that is that in many contentions exploring and explaining the outside world, there is only one actual answer; either X is, or X isn't. As such, a scientific consensus is both a blessing and a curse because a consensus is what would be expected if we were right about a particular contention as we all alight on the one that obviously works, but it's also the way we humans are most likely to fool ourselves; problems of induction and group-think combining in powerful repression. We could, of course, all be wrong - there may be some compelling piece of evidence no one has yet seen that totally changes the entire vista of our biological history... but there might also not be any such revolutionary evidence to be found, and what we've got now is, for all intents and purposes, right. We can't figure in evidence that we don't even know exists, we can only work with the evidence we do have now, and that evidence wholly attracts to the evolution of human primates back through geological history.

No evidence exists for the evolution of modern apes.

Aside from all the numerous lines of typical evidence he's either unaware of or in denial of, the assertion here is typical of those who emote at the world and have no comprehension of their own thought processes dictating poor comprehension.

The very existence of 'modern apes' presents a problem that needs to be solved. They are there, where did they come from?

To answer that question from an empirical perspective, we'd look back through history, see the physical, empirical evidence of the past, and hope thereby to trace the ancestors of our ancestors.

Luckily, the nature of the world means that a historical book of empirical evidence is preserved through geological stratigraphy. The law (a logical law, at that) of superposition requires that the oldest strata of an undeformed stratigraphic sequence must be deeper than the younger ones. Strata are very easy to detect for numerous reasons, from the pollen content (down to a seasonal level), to the soil's chemical composition, to radiometric dating - there are dozens of independent lines of evidence to show the age both comparative and absolute of a given strata.

So when we look back past the Bronze Age and late Palaeolithic to an Earth populated more by hunter-gatherers, we find the tools they carried, the items they made, the carcasses of animals they ate and butchered, and their skeletal remains... all of which is actually part of an epoch and location rich in other evidence which can further contextualize the stone-age human's world. Aside from their material culture, we can also see the slight differences in their skeletal anatomy. These differences are, of course, about aggregates and norms, not about individuals - like all living organisms, human's traits fall into normative distributions. On the whole, those stone-age human beings looked very much like us, with some quite telling differences.

When we look back past the flourishing of Homo sapiens, we see a very different picture all together. Now there are many human groups distributed around the world, and we can no longer ignore them just because we know which branch turned out to be us. Each group possessed a suite of differences, from minor things like the thickness of the enamel on a tooth, to the cubic centimetres of the brain case. Again, for all these groups we find evidence showing their material culture, their social groupings, their consumption and production patterns, and of course their skeletal anatomy.

If we keep going back, we find those groups of pre-humans slowly becoming more and more alike, their differences ironed out as they return back to a common ancestor which still shares many behavioral and biological characteristics even with us today - shares far more than is different. The skeletal anatomy is basal and its form is shared by all the descendants, through all the different forms, up until and including us modern humans.

As such, not only is there evidence, but there is an incredible weight of evidence for the evolution of humans, with several dozen identified species in our immediate family group, and of course, no evidence contradicting the notion, no experiments falsifying it - just people who reject it on wholly religious grounds.

Anyone can line up fossils fragments, and make the specious claim that one evolved into the other. Pure science fiction.

The only science fiction therein ironically is the notion that anyone can line up fossil fragments.

It's actually bloody hard, and if done wrong very easy for a fellow expert to debunk.

In recent years, there has been a huge technological advance made in areas that help closely inspect, map, model, and assess fossils and the strata they come from. This has provided such an enormous expansion of our vista and understanding it's beyond recognition comparative to 30 years ago. Whenever such dramatically improved techniques come along, it always presents a big opportunity for falsification, for testing again old ideas that were tenuously held. As is historically the case with evolution every time a giant advance has come along, it has weathered the scrutiny of falsification. Far from falsifying evolution, the view provided by the new equipment corroborates and adds vast detail to our evolutionary history.

Evolution has been shown beyond credible doubt even for those of us who are specialists in relevant fields, so certainly beyond so for those whose biological education ceased in high-school, and yet more so for someone who shows such utter ignorance about science and how science works. People who don't know their arses from their elbows don't have a seat at a serious table.

 

[Dragan Glas]

Greetings,

Fossils like this one

Kindest regards,

James

 

[AronRa]

This is what he said after reading this thread.

You were misleading.
1. You gave the impression that you knew that I followed a religion
2. You conflated creationists rejection of the bogus theory of evolution with a rejection of all scientific fields. This you do all the time.Evolution is not a synonym for science
3. You try to get your viewers to believe that only creationists disagree with what you are saying and no evolutionists do. That is hugely misleading

And that's just your first paragraph. That's what I meant about how time-consuming it would be to wade
through your swamp of propaganda before even getting to the more sustative topics

I told him there is no scientific opposition to evolution, only a religious one: and that if he's not a creationist, why does he feature an intelligent video on his YouTube channel? He says that doesn't mean anything because only one of his five featured videos promotes creationism. The rest are about random whatever and are irrelevant.

If he ever shows up here, I'll explain to him how all branches of creationism admit that they're opposed to evolution specifically, but that they're really against methodological naturalism. If the opposition to evolution is also in oppostion to scientific methodology itself, then acceptance of science means acceptance of evolution.

 

[Sparhafoc]

You were misleading.
1. You gave the impression that you knew that I followed a religion
2. You conflated creationists rejection of the bogus theory of evolution with a rejection of all scientific fields. This you do all the time.Evolution is not a synonym for science
3. You try to get your viewers to believe that only creationists disagree with what you are saying and no evolutionists do. That is hugely misleading

And that's just your first paragraph. That's what I meant about how time-consuming it would be to wade
through your swamp of propaganda before even getting to the more sustative topics

1) The only platform for the denial of biological evolution is religious belief.

2) Creationists rejection of biological science is a rejection of all science. Of course, they don't understand this thinking they get to pick and choose the findings of science which don't contradict their religious narrative, but all science is predicated on the same methodology. In reality, the evolutionary synthesis is the foundational theory of all modern Biology and is one of the best studied and evidenced scientific theories in the entire scientfic endeavour.

3) That's just bullshit. Only religious people dispute the fact of evolution.

The final paragraph suggests you think you've worked hard here whereas all you've done is write some assertions of blanket denial. Everyone here knows the depth, specifically lack thereof, which Creationists can achieve on topics like biological evolution, so please don't fool yourself into thinking that your audience here is sufficiently credulous to buy into this empty posturing.

Instead, do feel free to come and post directly into the thread where we will happily provide you the education you are so clearly lacking.

 

[AronRa]

Owens says he can't participate in this thread because he never got a confirmation email. Who can re-send that?

 

[Deleted member 619]

It's sent automatically. Probably in his spam folder.

If not, if he tries to log in, he should get a message saying that his account hasn't been activated and give him the option to resend the confirmation, IIRC. It's a while since I did anything phpbb related.

 

[Visaki]

It's sent automatically. Probably in his spam folder.

If not, if he tries to log in, he should get a message saying that his account hasn't been activated and give him the option to resend the confirmation, IIRC. It's a while since I did anything phpbb related.

Also, if the old rules apply, his first message has to be approved by a mod. This is just an anti bot measure, and they usually do it pretty quickly.

 

[Collecemall]

I made a new account out of curiosity. Apparently an admin has to approve new accounts. Not automated. It says the admin will get an email. So he is likely waiting on a mod to approve his account. As someone mentioned there might also be a wait for his first post as well. Not sure who handles either of those duties though.

 

[Rumraket]

In the mean time I'm interested to see his response to the phylogeny challenge.

In particular, I'm interested in hearing how he intends to account for the fact that phylogenetic trees constructed from independent data sets (be they unliked genetic loci, or morphology), are highly congruent.

In other words, why is it that we can build highly convergent trees (meaning the trees have highly similar branching orders) using a phylogenetic algorithm which does not group taxa together by mere similarity, using two or more genes with independent nucleotide sequences, from all of the primates?

The picture of the primate molecular phylogeny shown in AronRa's post is nothing short of incredible. Notice what it says in the figure legend:
"Here we provide new genomic sequence (∼8 Mb) from 186 primates representing 61 (∼90%) of the described genera, and we include outgroup species from Dermoptera, Scandentia, and Lagomorpha."

8 mega bases of DNA sequences (corresponding to ~43000 DNA bases, from each of those 186 primate species). I cannot even begin to tell you how unfathomable the level of statistical support for the common ancestry of primates that data set potentially provides. They used 54 independent nuclear genes, constructed phylogenetic trees from each of those 54 genes (sequenced from each of those 186 primates), and then compared the trees to each other. All 54 trees were overwhelmingly similar, with only minor numbers of incongruent branches.

If you read the original paper, you will see that there are a number of trees derived from the 54 independent data sets, with some incongruent branches. Even so, the extend to which these trees nevertheless support and corroborate each other is astonishing.

In Douglas Theobald's 29+ Evidences for Macroevolution - The Scientific Case for Common Descent there is a section devoted to the convergence of independent phylogenies, and the associated statistics of phylogenetic trees.

According to the phylogenetic trees-calculator on that page, we can see that there are 8.3803*10[sup]394[/sup] possible phylogenetic trees for a rooted phylogeny containing 186 taxa. Eight times ten to the three hundred and ninety fourth power. This number is incomprehensible.

In other words, there are 8.3803*10[sup]394[/sup] ways to arrange the branches in the tree figure AronRa provided.

That means two independent genetic loci has 8.3803x10[sup]394[/sup] ways to fail to corroborate each other for a tree constructed using those 186 taxa. So when we find that they nevertheless DO corroborate each other, that is a result that cries out for an explanation. And every one of those 54 gene-trees significantly corroborate each other. How significantly?

Even if those trees were to have 90 incongruent branches (they don't, they actually have less than 20 incongruent branches), it would still yield a result with a significance of P ≤ 3.14423*10[sup]-318[/sup].

What dear Mr. Owens needs to account for, is why there is such a level of convergence of independent phylogeneties, if there was no actual common descent of primates. This convergence is a prediction of the theory of common descent.

Let's try to put this into other words so it becomes more clear what I'm saying here.

To those of you who like watching youtube videos, you will no doubt have come across Lawrence Krauss giving one of his public lectures on theoretical physics and cosmology. In one of these lectures, you will hear Lawrence Krauss say something along the lines of "In quantum-electrodynamics you will find the greatest agreement between theory and observation in all of science, in that the fine structure constant has been observationally verified to an accuracy of fifteen decimal places."

What does that actually mean? Well it means that there is a theory (quantum electrodynamics), and this theory predicts a certain value that we should be able to measure in an experiment.
In particular, it predicts a certain value in the strength of the electromagnetic field that surrounds an charged elementary particle. Experimental physicists have measured this value, and found that it agrees with the value predicted by theory, to the 15th decimal place.

This is the 15th decimal place: 0.000000000000000
The measured value is actually: 0.0072973525664(17).

That is the accuracy with wich the theory that predicts the value of the fine structure constant, has been observationally verified. Physicists are rightly very proud of this prediction and the observational corroboration. Recall that every additional decimal place you can verify your theoretical prediction, corresponds to a reduction in the amount of uncertainty by a factor of ten. So going from 0.01 to 0.001 means you are ten times less uncertain about the real value.

But Lawrence Krauss is wrong. The greatest agreement between theory and observation in all of science, is the agreement between the theory of common descent, and the statistical significance of the convergence of independent phylogenetic trees. As we have just seen above, the phylogenetic tree of primates have been observationally verified to an accuracy of OVER THREE HUNDRED DECIMAL PLACES.

 

[Gnug215]

Owens says he can't participate in this thread because he never got a confirmation email. Who can re-send that?

There are currently no new posts waiting for approval, so I'm not sure what's going on.

Has he tried to make a new post? They should go through on his end, but then sit and wait for me to approve them.

 

[Collecemall]

In the mean time I'm interested to see his response to the phylogeny challenge.

In particular, I'm interested in hearing how he intends to account for the fact that phylogenetic trees constructed from independent data sets (be they unliked genetic loci, or morphology), are highly congruent.

In other words, why is it that we can build highly convergent trees (meaning the trees have highly similar branching orders) using a phylogenetic algorithm which does not group taxa together by mere similarity, using two or more genes with independent nucleotide sequences, from all of the primates?

The picture of the primate molecular phylogeny shown in AronRa's post is nothing short of incredible. Notice what it says in the figure legend:
"Here we provide new genomic sequence (∼8 Mb) from 186 primates representing 61 (∼90%) of the described genera, and we include outgroup species from Dermoptera, Scandentia, and Lagomorpha."

8 mega bases of DNA sequences (corresponding to ~43000 DNA bases, from each of those 186 primate species). I cannot even begin to tell you how unfathomable the level of statistical support for the common ancestry of primates that data set potentially provides. They used 54 independent nuclear genes, constructed phylogenetic trees from each of those 54 genes (sequenced from each of those 186 primates), and then compared the trees to each other. All 54 trees were overwhelmingly similar, with only minor numbers of incongruent branches.

If you read the original paper, you will see that there are a number of trees derived from the 54 independent data sets, with some incongruent branches. Even so, the extend to which these trees nevertheless support and corroborate each other is astonishing.

In Douglas Theobald's 29+ Evidences for Macroevolution - The Scientific Case for Common Descent there is a section devoted to the convergence of independent phylogenies, and the associated statistics of phylogenetic trees.

According to the phylogenetic trees-calculator on that page, we can see that there are 8.3803*10[sup]394[/sup] possible phylogenetic trees for a rooted phylogeny containing 186 taxa. Eight times ten to the three hundred and ninety fourth power. This number is incomprehensible.

In other words, there are 8.3803*10[sup]394[/sup] ways to arrange the branches in the tree figure AronRa provided.

That means two independent genetic loci has 8.3803x10[sup]394[/sup] ways to fail to corroborate each other for a tree constructed using those 186 taxa. So when we find that they nevertheless DO corroborate each other, that is a result that cries out for an explanation. And every one of those 54 gene-trees significantly corroborate each other. How significantly?

Even if those trees were to have 90 incongruent branches (they don't, they actually have less than 20 incongruent branches), it would still yield a result with a significance of P ≤ 3.14423*10[sup]-318[/sup].

What dear Mr. Owens needs to account for, is why there is such a level of convergence of independent phylogeneties, if there was no actual common descent of primates. This convergence is a prediction of the theory of common descent.

Let's try to put this into other words so it becomes more clear what I'm saying here.

To those of you who like watching youtube videos, you will no doubt have come across Lawrence Krauss giving one of his public lectures on theoretical physics and cosmology. In one of these lectures, you will hear Lawrence Krauss say something along the lines of "In quantum-electrodynamics you will find the greatest agreement between theory and observation in all of science, in that the fine structure constant has been observationally verified to an accuracy of fifteen decimal places."

What does that actually mean? Well it means that there is a theory (quantum electrodynamics), and this theory predicts a certain value that we should be able to measure in an experiment.
In particular, it predicts a certain value in the strength of the electromagnetic field that surrounds an charged elementary particle. Experimental physicists have measured this value, and found that it agrees with the value predicted by theory, to the 15th decimal place.

This is the 15th decimal place: 0.000000000000000
The measured value is actually: 0.0072973525664(17).

That is the accuracy with wich the theory that predicts the value of the fine structure constant, has been observationally verified. Physicists are rightly very proud of this prediction and the observational corroboration. Recall that every additional decimal place you can verify your theoretical prediction, corresponds to a reduction in the amount of uncertainty by a factor of ten. So going from 0.01 to 0.001 means you are ten times less uncertain about the real value.

But Lawrence Krauss is wrong. The greatest agreement between theory and observation in all of science, is the agreement between the theory of common descent, and the statistical significance of the convergence of independent phylogenetic trees. As we have just seen above, the phylogenetic tree of primates have been observationally verified to an accuracy of OVER THREE HUNDRED DECIMAL PLACES.

I've always thought this was a really powerful argument and set of data. Have you ever seen an attempt to actually deal with it? Besides hand waving I mean.

 

[Rumraket]

I've always thought this was a really powerful argument and set of data. Have you ever seen an attempt to actually deal with it? Besides hand waving I mean.

Yes well, the attempt is a form of handwaving and amounts to creationists uttering the phrase "common design", which they seem to think is a sort of "design plan" the creator was following.

They think this somehow is capable of accounting for why there are convergence of independent phylogenies. But it isn't, and I can demonstrate it. I'll go dig up a couple of posts from another forum where I demonstrate that the creationist rationalization about the nesting hierarchies and convergence of independent phylogenies, somehow inexorably follows from some "common design"-plan, in fact does not and is unfathomably unlikely to.

 

[Sparhafoc]

I've always thought this was a really powerful argument and set of data. Have you ever seen an attempt to actually deal with it? Besides hand waving I mean.

Of course: what would you expect from a common designer?

 

[Rumraket]

Okay, here follows some links to the forum posts (which I will just copy-paste here) where I explain to a creationist why the phrase "common design" actually does not explain the nesting hiearchy of life.



First, here: http://theskepticalzone.com/wp/common-design-vs-common-descent/comment-page-73/#comment-200074

In this forum post, I explain to the creationist Bill Cole why his idea, that the designer is using a "common design", by re-using newly designed "parts" (genes) and slightly tweaking them for functional reasons in new organisms, STILL does not yield convergence of independent phylogenies, or what is also known as the nesting hiearchy of life.


Bill Cole: Why would the re use of parts not show a pattern like this? In the case of cars new designs do not abandon older parts where those parts still do the job.

Rumraket: Yes Bill, but even if you do that, it doesn’t explain why the trees you get are so similar.
This is what you are supposed to explain, and which common descent does explain. Let’s try to cut it into tiny little bits so the logic becomes more obvious.

First of all, what is it you’re supposed to explain? The similarity of the trees.

Okay, what does that mean? It means the trees show similar branching orders. As in, some things are systematically grouped closer together (share more recent descent), than other things, no matter what attribute of the organism is used to construct the tree from.
Let’s dig into that even more. Suppose we want to use a particular gene to construct the tree from. We take the gene sequence of the gene from (say) 10 different organisms and compare them (make an alignment). Then we use a phylogenetic algorithm to make one or more trees from that alignment. We don’t tell the algorithm what species is what, or from what species the sequences come from. The only thing the algorithm knows is the sequence alignment we feed it.
An often used algorithm works like this: What evolutionary explanation (i.e. what tree) that invokes the least number of character state changes, explains this set of sequences?
Another way of saying the same thing is, how little evolution does it take to “make” all these sequences from a common ancestor, using only copying with mutations?
The algorithm then does this basically by comparing lots and lots of trees with the sequences at different branches, then counting how many total mutations it takes to make all the sequences given a certain tree, and gives it’s result(s) by showing the “best” tree(s). Some times there’s more than one “best” tree, as some of them have close or equal scores. A score here is, again, really just a reflection of how many “mutations” the tree implies. Lower is better with this sort of algorithm.

Okay? So we now have a gene sequence from several different species, and this set of gene sequences was used to built a tree with this method.

The question now is, suppose we take a different gene entirely, from the same 10 species, and submit it to the same algorithm, what kind of tree will the algorithm make? Well it turns out that, when we do this, we get a tree that is highly similar to the first one.
Some times they’re basically identical. Other times they’re not identical, but still very much similar to each other. So similar, in fact, that it demands an explanation why they are so consistently pretty much the same tree. Mammals (for example) will be grouped together. Rodents will always be inside the larger mammal clade. Primates will always be grouped together, and they’ll always be inside mammals. And so on and so forth.

Now you come along, and you say: I can explain that, it’s because there’s a designer that is re-using parts. Okay, let’s see if that’s correct.

So the designer has this “part”, a gene. She takes this gene-part she’s created, for this new organism she’s created, and copies it, because she intends to re-use it in a new organism. She does so. Creates a new organism, but re-uses the gene. So now two identical copies of the gene exist, one in each species. She does it again when creating the third species. Now three identical copies of the gene exists. She does it again for the fourth species, re-uses the gene-part. Now four identical copies exist. And so on and so forth until she’s created ten species with ten identical copies of that gene-part.

Maybe the gene looks like this:
CGTACGATACA

Now biologists come along and submit those ten identical copies of the gene to the above-mentioned phylogenetic algorithm. What do they get Bill? They get a star-tree without any groupings. Nothing is any further or any closer to any other member, than to anything else. They’re all equally distant from each other, because the gene is identical in all twenty species. So the tree is just a star with ten branches all connected to the same node (actually it comes out as a dot, because the branches has zero length).

Okay, so simply re-using the part doesn’t explain the nested hiearchy. Much less why different genes would ever yield similar trees.

Hold on! You say. Perhaps the designer slightly tweaks the re-used part every time for functional reasons? Perhaps the part NEEDS to be sliightly different in a specific way, in order to function in a slightly different way in the new species the designer creates? And THEN you’d get differences that give hiearchical structure to the tree. Okay, let’s run with that.

So the designer copies the gene from the first organism, then slightly alters it in a particular location in order for it to function in a particular way. Then she does the same thing again for the third species. But does she take the first gene again and copy it, and then slightly alter it? Or does she take the second gene, the one that was already altered a bit? Either way, we end up with a third copy that is not identical to the 1st or 2nd copy. And so on and so forth, until we have ten copies of the gene, but all of them slightly different from each other.

Maybe the first gene the designer made looks like this:
CGTACGATACA

And then She makes another 10 altered versions of it. The copy she makes for species #2 needs a particular change to function. Like this:
GGTACGATACA
That first G there is important for function in species #2. It isn’t randomly chosen, it’s chosen for a functional reason.
Then she makes one for species #3:
CGTACGTTTCA
Those T’s are important, they were chosen for a functional reason. That’s the idea. Moving on.
#4
CGTGCGATACT
#5
AGTACGTTTCG
#6
CGTACGCTACA
#7
CTTACGATTCA
#8
CGAACGATACC
#9
CGAAGGATACG
#10
TTTGCGATACT

So there we go, 10 sequences. And they were designed by re-using a common template and then altered to suit particular functions in their respective species.

Now biologists come along and take this gene from the 10 organisms and make an alignment, and then use the algorithm to make a tree from the alignment. They get a particular tree this time, with some being closer to others. There are groups this time. I used an actual maximum parsimony algorithm to get this tree.

Luckily we only get one tree that is better than all others for this gene. (Link to the online maximum parsimony tool I used.)

But of course it takes more than one gene to make an organism, so the designer makes lots of genes by the same method for her 10 different species. She takes the 2nd gene and goes through a similar process as for the 1st gene. Copies it, makes some changes to it for functional reasons, inserts it into organism #2. Then copies it again, makes some more changes to it, inserts it into organism #3. And so on, until all 10 organisms now have two genes each. And the genes are all different, but sort of derivations of each other.
So let me do that, here’s 10 versions of Gene #2:

Species 1 ACATATAGCGG
Species 2 TCTTATAGCGG
Species 3 ACATATAGCTT
Species 4 ACCGCTAGCGG
Species 5 ACATCTAGCGG
Species 6 ACATATGGGGG
Species 7 CCGTATAGCGG
Species 8 ACATGGAGCGG
Species 9 TCATATAGCGG
Species 10 GCATAAGGGCG

She repeats this again with a third gene, makes ten versions of the third gene. Etc. etc.

Here’s a list of 10 versions of Gene #3

Species 1 AGCACACAAAC
Species 2 AGGGCACAAAC
Species 3 TGCACACTAAC
Species 4 AGCACATAAAT
Species 5 ATCACTCAAAC
Species 6 AGCACACAGGC
Species 7 CGCACATCTAC
Species 8 GGCCCACAATC
Species 9 AGCTCACATAC
Species 10 AGCTGAGATAC

(This is where I can’t be bothered making more genes up for this post, you get the point).

Now biologists come along again and see the 2nd and 3rd gene in the ten different organisms. They make a new alignment for the 2nd and 3rd gene and submit it to the algorithm. The algorithm produces a tree for each (the one that explains the 10 different sequences using the fewest number of mutations). What trees do we get for genes #2 and #3?

Let’s see:
Maximum parsimony tree for gene #2.*

Maximum parsimony tree for gene #3.**

Even by just eyeballing this we can see that these trees aren’t remotely similar.

* Note, the algorithm output four trees of equal score, but I just chose the first one of them for graphical representation. I have a text file that shows the 3 others.
** For gene 3 the algorithm output 22 different trees with equal scores, again I just chose the first one for graphical representation but have a text file that shows all 22.

But remember, the number of possible unrooted trees for 10 species is 2,027,025.

None of the trees output for these three genes, by the same algorithm, are remotely similar. So even if the designer re-uses the same general gene-template, and slightly alters it for functional reasons (or even aesthetic reason, like “hmm I like G’s here”), there’s still no reason they should yield highly similar branching patterns.

And remember also, in real life there are many many more genes and many many more species. And the genes are much much longer than my genes made of only 11 nucleotides.

Statistically speaking, there are only two options here. Either the designer is being deliberately deceptive with the real data sets from the diversity of life, and goes back on purpose and re-tweaks the copied genes with intent such that they yield similar trees when analyzed by the algorithm, or there was common descent. Is your designer deceptive on purpose, Bill?

 

[Rumraket]

The creationist Bill Cole then comes back with another rationalization in response to my post above, here:

Bill Cole: First, thank you for the very thoughtful argument.I am going to spend some time with it but I have one question.

You are assuming here the design process to set up your argument. What if the process is different then you imagine. In the computer world with perfect simulation as an assumption we would create the widget in software based on design rules. The sequences would be interdependent and a copy an individual sequence and modify process is not what we would use.

Rumraket: It is very hard to understand what you try to argue, but from the last sentence I gather that you suggest the sequences are actually interdependent. As in there are functional constraints on one sequence, that makes it so you have to make a particular set of changes to the other.

Put another way, you’re asking: What if the changes you make in the sequence of gene #1, makes it so you have to make a specific set of changes to the sequence of gene #2, otherwise they won’t work in combination. Do I have that correctly?

Bill Cole: Yes. The genome ( like a software program) is built on interdependent sequences. A designer, especially knows the connection between sequence change and function would be dealing with this as he moves from a mouse to a rat assuming each are independent designs. The genetic changes between humans and chimps is across 70% of the protein coding genes.

Rumraket: Yes it is true, genes often times “cooperate” to yield certain functions, and can some times be constrained at some sites to be intercompatible. A very simple example I can think of is a transcription factor that has to bind a particular stretch of DNA and thereby regulate a downstream gene. In this situation, the sequence of the DNA to which the TF binds, and the amino acid sequence of the TF itself, are co-dependent.

However, there are at least two very important caveats to this, that render your suggestion ineffective. First of all, the number of possible TF-to-DNA relationships that are possible, so unbelievably vastly outnumber the number of extant TF and DNA sequences, that it makes it incredibly unlikely that phylogenies constructed from orthologoues of each, will end up exhibiting similar branching patterns.
So there is sequence-constraint on both. But this relationship between them doesn’t dictate that if you change the sequence of the DNA in a particular way, that the changes to the sequence of the associated TF must be changed in a way that gives a phylogeny constructed from it, a similar branching order to the tree derived from the DNA binding spot. The constraint is in the direction of whether the TF will function. It is not in the direction of what kind of branching pattern a likelihood or parsimony algorithm makes. So on this fact alone, the suggestion you make doesn’t rescue a “design-plan” rationalization from the “twin nested hiearchy”.

Second. Even if there were such associations that are constrained to yield similar branching patterns. And to be clear, there are and the most obvious example is RNA-based transcription factors that bind complementarily to DNA, you wouldn’t compare the RNA TF to the DNA it binds, as they are directly complementary. We can simply detect such associations and avoid using them when inferring phylogenetic relationships. In other words, we just have to think about what data sets to use and pick the actually known to be independent ones.
To pick an example, we can compare trees from genes that are demonstrably independent in their sequences, like two enzymes in some metabolic pathway. The gene-sequence of enzyme 1 does not cause, nor is it caused, by the gene sequence in enzyme 8, in some long metabolic pathway. These two enzymes are constrained by the function they have, not by the order of amino acids in each other. Or we can just compare the RNA based transcription factor tree, to a tree derived from a locus elsewhere in the genome to which this RNA doesn’t bind. Or we can use SINE insertions, and compare them to enzymes, or to transcription factors and so on and so forth.

So no, it doesn’t work Bill. The fact that different genes are functionally interdependent doesn’t explain why they should yield similar branching orders. Only if they went through the same genealogical relationship would you expect that.

 

[Rumraket]

We go through a few more exchanges that you can read in that thread, until we get to the point where Bill Cole, honestly rather mindnumblingly declares that because evolution involves "random mutations", we would not expect the idependent trees to be significantly congruent even if there was common descent.

He says:
Bill Cole: The claim is a nested hierarchy is caused by inheritance yet according to the theory speciation occurs with isolated populations.Once the populations become isolated then random mutation starts to break down correlation and I would expect Rum’s result.

Which I then proceed to prove wrong with more examples:
Rumraket: No. I’m going to do it. I will make three gene sequences, and then I will evolve them by splitting, copying and introduce random mutation (using a dice-roller to determine which nucleotide position to mutate, and another dice roller to determine how it mutates) until we have 10 “species”. Then I will “evolve” those 10 species for a few generations with random deaths, copying of survivors and more random mutations. Then I’m going to make trees for all three genes and see if they match.

So there will be three levels of randomness.
1. Who gets to survive and who gets to die will be dermined randomly.
2. What nucleotide position mutates with be determined randomly.
3. What type of mutation it will be, will be dermined randomly.

Then I’m going to make trees for all three genes and see if they match. Then you will see the result. See you later.

Later on:
Rumraket: I have now generated the evolutionary history and the common ancestral genome.

The genome of the universal ancestor is:
Gene_1: AAGGCCCCATATCCTCTCCG
Gene_2: GAATACCGTTCCGGAGGGAT
Gene_3: GCGCACCTACTTCTCGTAAG

Here’s the evolutionary history generated by randomly determining deaths, this universal ancestor and it’s descendants will go through:

Now I will have to incrementally copy and randomly mutate the sequences according to this history.

Again later on:
Rumraket: Okay Bill, here are the results.

These are the gene-sequences for the surviving organisms.
Gene1:
Species_15 AAGGCCCCTTATCCTCTCCC
Species_20 AAGGCCCCTTATCCACTCCC
Species_10 AAGGCCCCAGATTCTCGCCG
Species_21 AAGGCTCCAGATTCTCGCCG
Species_11 AAGGACCCAGCTTCTCTCCG
Species_22 AAGGACCCCGCTTCTCTCCG
Species_4 TAGGCACAATATCCTCTCCG
Species_23 TAGGCACAAAATCCTCTCCG
Species_19 TAGGCACAATGGCCTCTCCG
Species_24 TAGGCACAATGGCCTCTTCG

Gene2:
Species_15 GAATGCCGTTTCGGAGGGAT
Species_20 GAATGCAGTTTCGGAGGGAT
Species_10 GAATAGCGTTCCGGCGAGAT
Species_21 GAATAGCATTCCGGCGAGAT
Species_11 CAATAGCGTTCCGGACAGAT
Species_22 GAATAGCGTTCCGGACAGAT
Species_4 GAATACCGTTCCGGAGAGAT
Species_23 GAATACCGTTCCGGAGAGAG
Species_19 GGATACCGTTCCGGAGACAT
Species_24 GGATACCTTTCCGGAGACAT

Gene3:
Species_15 GCGCTCCTACTTCTCGTAAG
Species_20 GCGCCCCTACTTCTCGTAAG
Species_10 GCGCTCCGTCTTCTCGTAAG
Species_21 GCGCTCCGTTTTCTCGTAAG
Species_11 GCGCTCCGACCTCTCGTAAC
Species_22 GCGCTCCGACCTCTCGCAAC
Species_4 CCGCACCTACTGCTCGTTAG
Species_23 CCGCACCTACTACTCGTTAG
Species_19 CCGCACCTACAGCTCGTTTG
Species_24 CCGCACCTACTGCTCGTTTG

I submitted all three lists to the maximum parsimony algorithm here: http://www.trex.uqam.ca/index.php?action=phylip&app=dnapars

All three gene lists yielded a single best tree.
Gene 1 tree.

Gene 2 tree.

Gene 3 tree.

Here’s a comparison so you can see them side by side.

How similar are those trees? Are some organisms systematically grouped together in all three trees? Yes they are. In fact all of them are. These trees are nearly identical.

In all three trees species 19 and 24 are close together.
In all three trees 23 and 4 are close together.
In all three trees 15 and 20 are close together.
In all three trees 10 and 21 are close together.
In all three trees 11 and 22 are close together.

But there’s even more recurrent hierarchical structure across the trees than that. In all three trees, 10, 11, 20 and 22 are close together and fall into a similar “clade”. The same is true for a clade that contains the members 4, 19, 23 and 24.

Now, compare those clades to the hypothetical evolutionary history I generated to begin with. For all three genes, the trees that the algorithm derives from them are very close to the actual history I generated.

In every concievable way, your intuition has failed you.

 

[Rumraket]

To sum up all of the above:

Common design, or "following a design-plan" where the designer is re-using slightly tweaked parts in new creations, demonstrably does not predict nesting hiearchical structure in the data sets.
Stated another way, there is NO reason to expect that "common design" should yield highly congruent independent phylogenetic trees.


There is only ONE predictive and observationally falsifiable explanation for this phenomenon: There must have been common descent by a branching evolutionary process.

This is the single greatest proof one could realistically imagine, for the reality of historical biological evolution. Of diversification of forms through branching descent with modification.


Darwin explained why there would be nesting hiearchical groupings (groups within groups) in 1859 in the 1st edition of The Origin of Species, and also explained why the creationist "creation plan" rationalization doesn't work:
“…So that we here have many species descended from a single progenitor grouped into genera; and the genera are included in, or subordinate to, sub-families, families, and orders, all united into one class. Thus, the grand fact in natural history of the subordination of group under group, which, from its familiarity, does not always sufficiently strike us, is in my judgment fully explained.
(...)
All the foregoing rules and aids and difficulties in classification are explained, if I do not greatly deceive myself, on the view that the natural system is founded on descent with modification; that the characters which naturalists consider as showing true affinity between any two or more species, are those which have been inherited from a common parent, and, in so far, all true classification is genealogical; that community of descent is the hidden bond which naturalists have been unconsciously seeking, and not some unknown plan of creation, or the enunciation of general propositions, and the mere putting together and separating objects more or less alike.
(...)
Nothing can be more hopeless than to attempt to explain this similarity of pattern in members of the same class, by utility or by the doctrine of final causes. The hopelessness of the attempt has been expressly admitted by Owen in his most interesting work on the 'Nature of Limbs.' On the ordinary view of the independent creation of each being, we can only say that so it is;—that it has so pleased the Creator to construct each animal and plant.

The explanation is manifest on the theory of the natural selection of successive slight modifications,—each modification being profitable in some way to the modified form, but often affecting by correlation of growth other parts of the organisation.” – Charles Darwin, The Origin of Species, 1st Edition.

 

[Rumraket]

I should add something here. The hypothetical evolutionary history I generated above is a rather poor substitute for real phylogenetic relationships, as some of the earliest generated organisms (like the one called Species_4) survived to the very last generation. This is why the maximum parsimony algorithm puts some of the species on internal nodes as the direct ancestors of other species, because they literally ARE their direct ancestors. One of these days I'm going go bother producing a more realistic data set, using more and longer genes, more species, and deeper relationships (with more generations between descendants).

Even despite these shortcomings of my example (shortcomings which, by the way, confound phylogenetic inference by significantly increasing the odds of character-state reversals (a mutation reverses to the ancestral state, in effect erasing the evidence that it ever changed), and increasing the odds of homoplasy (the same mutation happens in parallel in two independent lineages, aka convergent evolution)), the maximum parsimony algorithm was still able to correctly infer the genealogical relationships of the species on the basis of the three independent gene-trees, and they all significantly corroborate each other, despite the fact that there are over 2 million possible ways those trees could have turned out.

 

[Collecemall]

Thank you for all of this. Great stuff. I only had time to skim right now but will read it with more detail tonight.